ID: 1200053909

View in Genome Browser
Species Human (GRCh38)
Location X:153448823-153448845
Sequence GGGTCAACAGACCCTGGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053909_1200053925 22 Left 1200053909 X:153448823-153448845 CCCAGGCCAGGGTCTGTTGACCC No data
Right 1200053925 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG No data
1200053909_1200053927 23 Left 1200053909 X:153448823-153448845 CCCAGGCCAGGGTCTGTTGACCC No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053909_1200053923 21 Left 1200053909 X:153448823-153448845 CCCAGGCCAGGGTCTGTTGACCC No data
Right 1200053923 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200053909 Original CRISPR GGGTCAACAGACCCTGGCCT GGG (reversed) Intronic