ID: 1200053913

View in Genome Browser
Species Human (GRCh38)
Location X:153448843-153448865
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053913_1200053934 13 Left 1200053913 X:153448843-153448865 CCCGGCTGTGCCCCCGCCCACCT No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053913_1200053925 2 Left 1200053913 X:153448843-153448865 CCCGGCTGTGCCCCCGCCCACCT No data
Right 1200053925 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG No data
1200053913_1200053927 3 Left 1200053913 X:153448843-153448865 CCCGGCTGTGCCCCCGCCCACCT No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053913_1200053923 1 Left 1200053913 X:153448843-153448865 CCCGGCTGTGCCCCCGCCCACCT No data
Right 1200053923 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data
1200053913_1200053939 28 Left 1200053913 X:153448843-153448865 CCCGGCTGTGCCCCCGCCCACCT No data
Right 1200053939 X:153448894-153448916 GCACATGGCACACAGTGAGGAGG No data
1200053913_1200053938 25 Left 1200053913 X:153448843-153448865 CCCGGCTGTGCCCCCGCCCACCT No data
Right 1200053938 X:153448891-153448913 GCAGCACATGGCACACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200053913 Original CRISPR AGGTGGGCGGGGGCACAGCC GGG (reversed) Intronic