ID: 1200053914

View in Genome Browser
Species Human (GRCh38)
Location X:153448844-153448866
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053914_1200053925 1 Left 1200053914 X:153448844-153448866 CCGGCTGTGCCCCCGCCCACCTG No data
Right 1200053925 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG No data
1200053914_1200053934 12 Left 1200053914 X:153448844-153448866 CCGGCTGTGCCCCCGCCCACCTG No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053914_1200053923 0 Left 1200053914 X:153448844-153448866 CCGGCTGTGCCCCCGCCCACCTG No data
Right 1200053923 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data
1200053914_1200053927 2 Left 1200053914 X:153448844-153448866 CCGGCTGTGCCCCCGCCCACCTG No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053914_1200053939 27 Left 1200053914 X:153448844-153448866 CCGGCTGTGCCCCCGCCCACCTG No data
Right 1200053939 X:153448894-153448916 GCACATGGCACACAGTGAGGAGG No data
1200053914_1200053938 24 Left 1200053914 X:153448844-153448866 CCGGCTGTGCCCCCGCCCACCTG No data
Right 1200053938 X:153448891-153448913 GCAGCACATGGCACACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200053914 Original CRISPR CAGGTGGGCGGGGGCACAGC CGG (reversed) Intronic