ID: 1200053916

View in Genome Browser
Species Human (GRCh38)
Location X:153448854-153448876
Sequence GGGCAGGGGGCAGGTGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053916_1200053941 22 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053941 X:153448899-153448921 TGGCACACAGTGAGGAGGCAGGG No data
1200053916_1200053942 23 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053942 X:153448900-153448922 GGCACACAGTGAGGAGGCAGGGG No data
1200053916_1200053934 2 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053916_1200053927 -8 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053916_1200053925 -9 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053925 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG No data
1200053916_1200053940 21 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053916_1200053939 17 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053939 X:153448894-153448916 GCACATGGCACACAGTGAGGAGG No data
1200053916_1200053938 14 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053938 X:153448891-153448913 GCAGCACATGGCACACAGTGAGG No data
1200053916_1200053923 -10 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053923 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200053916 Original CRISPR GGGCAGGGGGCAGGTGGGCG GGG (reversed) Intronic