ID: 1200053921

View in Genome Browser
Species Human (GRCh38)
Location X:153448863-153448885
Sequence GGGCTTGGGGGGCAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053921_1200053939 8 Left 1200053921 X:153448863-153448885 CCTGCCCCCTGCCCCCCAAGCCC No data
Right 1200053939 X:153448894-153448916 GCACATGGCACACAGTGAGGAGG No data
1200053921_1200053934 -7 Left 1200053921 X:153448863-153448885 CCTGCCCCCTGCCCCCCAAGCCC No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053921_1200053938 5 Left 1200053921 X:153448863-153448885 CCTGCCCCCTGCCCCCCAAGCCC No data
Right 1200053938 X:153448891-153448913 GCAGCACATGGCACACAGTGAGG No data
1200053921_1200053942 14 Left 1200053921 X:153448863-153448885 CCTGCCCCCTGCCCCCCAAGCCC No data
Right 1200053942 X:153448900-153448922 GGCACACAGTGAGGAGGCAGGGG No data
1200053921_1200053941 13 Left 1200053921 X:153448863-153448885 CCTGCCCCCTGCCCCCCAAGCCC No data
Right 1200053941 X:153448899-153448921 TGGCACACAGTGAGGAGGCAGGG No data
1200053921_1200053940 12 Left 1200053921 X:153448863-153448885 CCTGCCCCCTGCCCCCCAAGCCC No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200053921 Original CRISPR GGGCTTGGGGGGCAGGGGGC AGG (reversed) Intronic