ID: 1200053922

View in Genome Browser
Species Human (GRCh38)
Location X:153448867-153448889
Sequence CCTGGGGCTTGGGGGGCAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053922_1200053943 28 Left 1200053922 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data
Right 1200053943 X:153448918-153448940 AGGGGCTGTCCTGACTTCAGTGG No data
1200053922_1200053942 10 Left 1200053922 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data
Right 1200053942 X:153448900-153448922 GGCACACAGTGAGGAGGCAGGGG No data
1200053922_1200053939 4 Left 1200053922 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data
Right 1200053939 X:153448894-153448916 GCACATGGCACACAGTGAGGAGG No data
1200053922_1200053938 1 Left 1200053922 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data
Right 1200053938 X:153448891-153448913 GCAGCACATGGCACACAGTGAGG No data
1200053922_1200053941 9 Left 1200053922 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data
Right 1200053941 X:153448899-153448921 TGGCACACAGTGAGGAGGCAGGG No data
1200053922_1200053940 8 Left 1200053922 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200053922 Original CRISPR CCTGGGGCTTGGGGGGCAGG GGG (reversed) Intronic