ID: 1200053924

View in Genome Browser
Species Human (GRCh38)
Location X:153448868-153448890
Sequence CCCTGGGGCTTGGGGGGCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2139
Summary {0: 1, 1: 0, 2: 20, 3: 156, 4: 1962}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053924_1200053941 8 Left 1200053924 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG 0: 1
1: 0
2: 20
3: 156
4: 1962
Right 1200053941 X:153448899-153448921 TGGCACACAGTGAGGAGGCAGGG No data
1200053924_1200053939 3 Left 1200053924 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG 0: 1
1: 0
2: 20
3: 156
4: 1962
Right 1200053939 X:153448894-153448916 GCACATGGCACACAGTGAGGAGG No data
1200053924_1200053938 0 Left 1200053924 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG 0: 1
1: 0
2: 20
3: 156
4: 1962
Right 1200053938 X:153448891-153448913 GCAGCACATGGCACACAGTGAGG No data
1200053924_1200053940 7 Left 1200053924 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG 0: 1
1: 0
2: 20
3: 156
4: 1962
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053924_1200053943 27 Left 1200053924 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG 0: 1
1: 0
2: 20
3: 156
4: 1962
Right 1200053943 X:153448918-153448940 AGGGGCTGTCCTGACTTCAGTGG No data
1200053924_1200053942 9 Left 1200053924 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG 0: 1
1: 0
2: 20
3: 156
4: 1962
Right 1200053942 X:153448900-153448922 GGCACACAGTGAGGAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200053924 Original CRISPR CCCTGGGGCTTGGGGGGCAG GGG (reversed) Intronic