ID: 1200053927

View in Genome Browser
Species Human (GRCh38)
Location X:153448869-153448891
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053909_1200053927 23 Left 1200053909 X:153448823-153448845 CCCAGGCCAGGGTCTGTTGACCC No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053908_1200053927 29 Left 1200053908 X:153448817-153448839 CCGAGACCCAGGCCAGGGTCTGT No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053914_1200053927 2 Left 1200053914 X:153448844-153448866 CCGGCTGTGCCCCCGCCCACCTG No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053916_1200053927 -8 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053917_1200053927 -9 Left 1200053917 X:153448855-153448877 CCCGCCCACCTGCCCCCTGCCCC No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053915_1200053927 -7 Left 1200053915 X:153448853-153448875 CCCCCGCCCACCTGCCCCCTGCC No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053912_1200053927 17 Left 1200053912 X:153448829-153448851 CCAGGGTCTGTTGACCCGGCTGT No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053910_1200053927 22 Left 1200053910 X:153448824-153448846 CCAGGCCAGGGTCTGTTGACCCG No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053918_1200053927 -10 Left 1200053918 X:153448856-153448878 CCGCCCACCTGCCCCCTGCCCCC No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
1200053913_1200053927 3 Left 1200053913 X:153448843-153448865 CCCGGCTGTGCCCCCGCCCACCT No data
Right 1200053927 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type