ID: 1200053934

View in Genome Browser
Species Human (GRCh38)
Location X:153448879-153448901
Sequence CAAGCCCCAGGGGCAGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053916_1200053934 2 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053921_1200053934 -7 Left 1200053921 X:153448863-153448885 CCTGCCCCCTGCCCCCCAAGCCC No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053915_1200053934 3 Left 1200053915 X:153448853-153448875 CCCCCGCCCACCTGCCCCCTGCC No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053918_1200053934 0 Left 1200053918 X:153448856-153448878 CCGCCCACCTGCCCCCTGCCCCC No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053919_1200053934 -3 Left 1200053919 X:153448859-153448881 CCCACCTGCCCCCTGCCCCCCAA No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053914_1200053934 12 Left 1200053914 X:153448844-153448866 CCGGCTGTGCCCCCGCCCACCTG No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053917_1200053934 1 Left 1200053917 X:153448855-153448877 CCCGCCCACCTGCCCCCTGCCCC No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053920_1200053934 -4 Left 1200053920 X:153448860-153448882 CCACCTGCCCCCTGCCCCCCAAG No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053912_1200053934 27 Left 1200053912 X:153448829-153448851 CCAGGGTCTGTTGACCCGGCTGT No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data
1200053913_1200053934 13 Left 1200053913 X:153448843-153448865 CCCGGCTGTGCCCCCGCCCACCT No data
Right 1200053934 X:153448879-153448901 CAAGCCCCAGGGGCAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200053934 Original CRISPR CAAGCCCCAGGGGCAGCACA TGG Intronic