ID: 1200053940

View in Genome Browser
Species Human (GRCh38)
Location X:153448898-153448920
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 19 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200053918_1200053940 19 Left 1200053918 X:153448856-153448878 CCGCCCACCTGCCCCCTGCCCCC No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053931_1200053940 -1 Left 1200053931 X:153448876-153448898 CCCCAAGCCCCAGGGGCAGCACA No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053935_1200053940 -8 Left 1200053935 X:153448883-153448905 CCCCAGGGGCAGCACATGGCACA No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053915_1200053940 22 Left 1200053915 X:153448853-153448875 CCCCCGCCCACCTGCCCCCTGCC No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053930_1200053940 0 Left 1200053930 X:153448875-153448897 CCCCCAAGCCCCAGGGGCAGCAC No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053937_1200053940 -10 Left 1200053937 X:153448885-153448907 CCAGGGGCAGCACATGGCACACA No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053916_1200053940 21 Left 1200053916 X:153448854-153448876 CCCCGCCCACCTGCCCCCTGCCC No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053924_1200053940 7 Left 1200053924 X:153448868-153448890 CCCCTGCCCCCCAAGCCCCAGGG 0: 1
1: 0
2: 20
3: 156
4: 1962
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053932_1200053940 -2 Left 1200053932 X:153448877-153448899 CCCAAGCCCCAGGGGCAGCACAT No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053928_1200053940 5 Left 1200053928 X:153448870-153448892 CCTGCCCCCCAAGCCCCAGGGGC No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053919_1200053940 16 Left 1200053919 X:153448859-153448881 CCCACCTGCCCCCTGCCCCCCAA No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053933_1200053940 -3 Left 1200053933 X:153448878-153448900 CCAAGCCCCAGGGGCAGCACATG No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053920_1200053940 15 Left 1200053920 X:153448860-153448882 CCACCTGCCCCCTGCCCCCCAAG No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053929_1200053940 1 Left 1200053929 X:153448874-153448896 CCCCCCAAGCCCCAGGGGCAGCA No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053926_1200053940 6 Left 1200053926 X:153448869-153448891 CCCTGCCCCCCAAGCCCCAGGGG No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053917_1200053940 20 Left 1200053917 X:153448855-153448877 CCCGCCCACCTGCCCCCTGCCCC No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053922_1200053940 8 Left 1200053922 X:153448867-153448889 CCCCCTGCCCCCCAAGCCCCAGG No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053921_1200053940 12 Left 1200053921 X:153448863-153448885 CCTGCCCCCTGCCCCCCAAGCCC No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data
1200053936_1200053940 -9 Left 1200053936 X:153448884-153448906 CCCAGGGGCAGCACATGGCACAC No data
Right 1200053940 X:153448898-153448920 ATGGCACACAGTGAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type