ID: 1200055178

View in Genome Browser
Species Human (GRCh38)
Location X:153456500-153456522
Sequence AGTCATCACTCTGCTTGTTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 128}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200055175_1200055178 -2 Left 1200055175 X:153456479-153456501 CCAGGAGCACGTACCACTGCCAG 0: 1
1: 0
2: 0
3: 8
4: 147
Right 1200055178 X:153456500-153456522 AGTCATCACTCTGCTTGTTGAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1200055173_1200055178 10 Left 1200055173 X:153456467-153456489 CCACTGAGGCCTCCAGGAGCACG 0: 1
1: 0
2: 0
3: 27
4: 224
Right 1200055178 X:153456500-153456522 AGTCATCACTCTGCTTGTTGAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1200055171_1200055178 21 Left 1200055171 X:153456456-153456478 CCAGGGTGCTGCCACTGAGGCCT 0: 1
1: 0
2: 1
3: 31
4: 316
Right 1200055178 X:153456500-153456522 AGTCATCACTCTGCTTGTTGAGG 0: 1
1: 0
2: 1
3: 18
4: 128
1200055174_1200055178 1 Left 1200055174 X:153456476-153456498 CCTCCAGGAGCACGTACCACTGC 0: 1
1: 0
2: 0
3: 8
4: 101
Right 1200055178 X:153456500-153456522 AGTCATCACTCTGCTTGTTGAGG 0: 1
1: 0
2: 1
3: 18
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200055178 Original CRISPR AGTCATCACTCTGCTTGTTG AGG Exonic
903092702 1:20936363-20936385 AAGGATCACTCTGCTTGTTTTGG + Intronic
904493829 1:30875950-30875972 AGGCATCACTCGCCTTGTGGAGG - Intronic
904837254 1:33347342-33347364 AGTCATCATTCTCCTGGCTGTGG - Intronic
904848009 1:33435314-33435336 AGTCATCACTGTGTCTATTGTGG - Intergenic
905869969 1:41397795-41397817 TGTCATCTCTCTGCTTGTCTAGG + Intergenic
906733612 1:48104092-48104114 AGTTACCAATCTGCGTGTTGGGG + Intergenic
907434945 1:54439552-54439574 ATTCGTCACTCTGCTTTCTGTGG + Intergenic
910040118 1:82840449-82840471 AGTCATCACTCTCATTGCAGAGG - Intergenic
910528812 1:88212140-88212162 GGTCCTAACTCTGCTTCTTGAGG - Intergenic
911365795 1:96936040-96936062 AAGGATCACTCTGCCTGTTGAGG + Intergenic
911506275 1:98756627-98756649 AGTCAGTACTCTGCTTGGTGTGG + Intronic
912313289 1:108644592-108644614 AGTCATCCCTCTGCTCACTGAGG + Intronic
918365967 1:183807891-183807913 AGTCATCACTTTGTTTTTGGTGG + Intronic
918996310 1:191764888-191764910 AGTCATCATTCTTTTTGTTGTGG + Intergenic
919188645 1:194186950-194186972 AGCCATCATTCTCCTTGATGTGG - Intergenic
1065046183 10:21749216-21749238 ATTCATCCATCTGCTTGTTACGG - Intergenic
1066002956 10:31121388-31121410 TGTCATCACTCTGCCTGTGTAGG + Intergenic
1067149129 10:43715245-43715267 AGTCATCACTGTCCTTGTGGAGG - Intergenic
1069244288 10:66182981-66183003 AGTGAACACTCTGCTGGGTGAGG - Intronic
1069367389 10:67708226-67708248 TGTAATTACTCTGCTTGTTAAGG - Intergenic
1074061143 10:109966852-109966874 AGTTATTACTTTGCTGGTTGGGG + Intergenic
1074384347 10:113005263-113005285 CGTCAGCACTGTGCATGTTGTGG + Intronic
1081018311 11:37909696-37909718 AGTAAGCTATCTGCTTGTTGTGG + Intergenic
1084682514 11:70674752-70674774 ACTACTCACTCTGCTAGTTGTGG + Intronic
1088312036 11:108470380-108470402 AGGCATCAATCCTCTTGTTGAGG + Intergenic
1091139803 11:133225108-133225130 AGTAATAACTCAGCTCGTTGGGG + Intronic
1095175144 12:39083534-39083556 AGACATCACTCTGCATGTTAGGG + Intergenic
1097969069 12:65612855-65612877 AGTCACCACTCAGAATGTTGGGG + Intergenic
1098358290 12:69631227-69631249 AGTCATCCCTCTGCTCACTGAGG - Intergenic
1099938483 12:89156889-89156911 AGTCATCTCTCTGCTTTCAGTGG - Intergenic
1101220354 12:102632575-102632597 AGTTATCAATCTGCTGGGTGCGG + Intergenic
1102122592 12:110453862-110453884 AGTCATCAATCTACAAGTTGTGG + Exonic
1104165102 12:126220177-126220199 AGTCATCACTTTGATTTGTGAGG + Intergenic
1104211292 12:126691274-126691296 AGCCAAAACTCTGCTTCTTGGGG - Intergenic
1111511691 13:89273242-89273264 AGACGTCACTCTGGTTGTTCTGG - Intergenic
1111660716 13:91207118-91207140 AGTCATCACTAAGTTTTTTGTGG + Intergenic
1112009162 13:95279678-95279700 AGTCCTCACAGTGCTTTTTGTGG + Intronic
1112208485 13:97348707-97348729 AGTCATAGCTCTCCTTCTTGAGG - Intronic
1118470764 14:66073373-66073395 AGGCAGCCCTCTGCTTGCTGGGG + Intergenic
1118970729 14:70635277-70635299 AGTCATCTTTCTGCTTCATGAGG + Intergenic
1120354468 14:83413018-83413040 AGTCAGCACTCCTCTGGTTGTGG + Intergenic
1120484346 14:85092244-85092266 TGTCATCATTCTATTTGTTGAGG + Intergenic
1124065098 15:26335187-26335209 AGTCCTCAAACTGCTGGTTGGGG - Intergenic
1126410561 15:48368991-48369013 AGTGATCACTCTCCTTCTTTTGG + Intergenic
1130784396 15:87080181-87080203 AATCATCATTATGGTTGTTGGGG + Intergenic
1133699708 16:8297583-8297605 GGTCATCTCTCTGCATGTTTTGG - Intergenic
1134755038 16:16659608-16659630 AGGCATGACTCTGCTGGGTGTGG - Intergenic
1134991025 16:18699565-18699587 AGGCATGACTCTGCTGGGTGTGG + Intergenic
1135662402 16:24307871-24307893 ATTCATAACTCTACTTCTTGGGG + Intronic
1135866248 16:26105066-26105088 AGACATCACTGTGATTGCTGTGG - Intronic
1137897176 16:52226539-52226561 AGGCATCACCCAACTTGTTGAGG - Intergenic
1143496200 17:7314071-7314093 AGTCCTCACCCTGCATGCTGAGG + Exonic
1150846092 17:68659561-68659583 AATCATCACTCAGCTGGGTGTGG + Intergenic
1150881376 17:69032518-69032540 AGACATCTCTCTGCATTTTGAGG - Intronic
1152198003 17:78928762-78928784 AGTCATCTCCCTGCTGCTTGGGG + Intergenic
1153224772 18:2891177-2891199 AGTCATCACACTGCTGCTGGAGG - Exonic
1153373739 18:4352463-4352485 AGTCACTGTTCTGCTTGTTGTGG + Intronic
1153447039 18:5185651-5185673 AATAGTCACTCTGATTGTTGTGG - Intronic
1156058847 18:33047841-33047863 AGCCATCAATTTGCTTTTTGTGG + Intronic
1158872979 18:61706816-61706838 TGTAATCACTTTGCTTCTTGTGG + Intergenic
1159348539 18:67239418-67239440 ACTCAGCACTCTGCTGGATGTGG - Intergenic
1160597181 18:79984160-79984182 AGTCAACACTCAGCTAGATGAGG - Intronic
1162650514 19:12085280-12085302 AGTCATCACTCTCTTTGTTATGG + Intergenic
1163898529 19:20080455-20080477 ACTCATCCTTCTGCTTCTTGTGG + Intronic
1166542286 19:43613303-43613325 TGTGATCTCTCTGCTTGTTGGGG - Exonic
1166542354 19:43613915-43613937 TGTAACCACTCTGCTTATTGGGG - Exonic
1166626250 19:44358805-44358827 ATTCTTCACTCTGCTTTATGGGG + Intronic
925674553 2:6347141-6347163 AGTCATCACTCTGCCTGATGAGG - Intergenic
931375591 2:61704950-61704972 AGTCATTATTCTGTCTGTTGTGG + Intergenic
933692394 2:85189616-85189638 AGTCTTCACACTGCTCTTTGTGG + Intronic
933700426 2:85251504-85251526 AGTCATCACACTGCTAATTGGGG + Intronic
935256062 2:101310609-101310631 ATACATCACTGTGCTAGTTGAGG - Intergenic
939265429 2:139866575-139866597 AGTAATCACTCTGCTTTTAAGGG - Intergenic
939350476 2:141030876-141030898 AGTCATCACTCATTTTTTTGAGG + Intronic
940736568 2:157460073-157460095 AAAAATCACTCTGCTTGTTCTGG - Intronic
942306748 2:174615986-174616008 AGTCATCACTTTGCTTGGCTAGG + Intronic
943037537 2:182765644-182765666 AGTCATCACCTTCATTGTTGTGG + Intronic
944306080 2:198181370-198181392 GATCAACATTCTGCTTGTTGTGG - Intronic
945655683 2:212620309-212620331 AGTCAGAACTTTGCTTGTTCAGG - Intergenic
1168742836 20:208894-208916 AATAATCATTCTGGTTGTTGGGG - Intergenic
1169956960 20:11114290-11114312 AGCCTTCACACTGCTTGTTTTGG + Intergenic
1171444213 20:25192213-25192235 CGTCAGCTCTCTGATTGTTGTGG - Intergenic
1171876104 20:30578346-30578368 ATTCTTCACTCTGCTTTATGGGG - Intergenic
1179086299 21:38220849-38220871 TTTCATCACTCAGGTTGTTGTGG - Intronic
1179957114 21:44747507-44747529 AGTCATCCCTCTGCTCACTGAGG + Intergenic
1179967577 21:44816402-44816424 AGTCTGCACTCTGCTTGCTGTGG - Intronic
951071441 3:18333411-18333433 AGTCATGAATCTGCAGGTTGTGG + Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
959136134 3:102423726-102423748 AGTTATCTCTCTGCTTCTTGAGG - Intronic
965126804 3:164640823-164640845 AGTCATCATGCTGCTTGTAGAGG - Intergenic
965609503 3:170529869-170529891 AGGCATCCCTTTGCTTGTAGAGG - Intronic
967812456 3:193772318-193772340 AGTCATCGCTCGTCTTGCTGTGG + Intergenic
975647205 4:76556854-76556876 AGTCATCGCTGTGTTTTTTGTGG - Intronic
976204127 4:82608586-82608608 AGTGATCACTCTGCCTATTGGGG + Intergenic
977741879 4:100494283-100494305 AGAAATAACTCTGCATGTTGTGG + Intronic
979755283 4:124332686-124332708 CATCATCACTCTGCTTGGTTGGG + Intergenic
980764013 4:137275098-137275120 AGTCTTCAGTCTGCATGTTTGGG + Intergenic
982659836 4:158193322-158193344 AGGGATCACTCTGGTTGTTATGG + Intergenic
983426011 4:167583817-167583839 AGTCATCCCTCTGCTCACTGAGG - Intergenic
985789060 5:1915677-1915699 AGCCATCACGCTCCTTGCTGAGG - Intergenic
986441289 5:7784419-7784441 CTTCATCACACTGCTTGTTCTGG + Exonic
990463057 5:56047416-56047438 AGTAATCACTTTGATTTTTGGGG - Intergenic
993949254 5:94153444-94153466 AGTCACACCTCTGCTTGTAGTGG - Intronic
994550298 5:101225995-101226017 ATTCATCCCTCTCCTTGATGTGG + Intergenic
995589578 5:113685493-113685515 AGTCATCACTTGGCTTGATTAGG + Intergenic
996972083 5:129383410-129383432 AGTCATCCCTCTGTATGCTGGGG + Intergenic
1001629417 5:173163649-173163671 AGACCTCACTCTGCTGGCTGGGG - Intronic
1002317980 5:178356730-178356752 AGGCATCACTCTGCTGGGTTTGG - Intronic
1003634635 6:7821090-7821112 GGACATCATTCTGCCTGTTGTGG + Intronic
1013678464 6:112494251-112494273 AGACATCACTCTACTTCTAGGGG + Intergenic
1020913874 7:14167606-14167628 AGTCATCAGTATGTTTGTTAAGG - Intronic
1021757368 7:23866008-23866030 AGTCTTCAGTATGGTTGTTGAGG + Intergenic
1023683984 7:42716754-42716776 AGGCATCCCTCTCCTTGTCGAGG + Intergenic
1024987126 7:55205148-55205170 TGTCATAAGTCTCCTTGTTGAGG + Intronic
1026145913 7:67746653-67746675 AATCAGCACCATGCTTGTTGTGG - Intergenic
1028648951 7:93129014-93129036 AGTCATCCCTCTGCTCACTGAGG + Intergenic
1030647519 7:112079545-112079567 ATTCAACTCTCAGCTTGTTGTGG - Intronic
1031837254 7:126692413-126692435 AGTCATCACTGTCCTTGGTGGGG - Intronic
1039110758 8:34038782-34038804 AGTCATCCCTCTGCTCACTGAGG + Intergenic
1039926847 8:41941817-41941839 AGTATTCACTTTGCTTATTGAGG - Intronic
1041344885 8:56886913-56886935 AGTCTACACTCTGCTAGTTTGGG + Intergenic
1041872983 8:62656037-62656059 AGCCATCACTCTGGTCTTTGTGG - Intronic
1044387011 8:91601157-91601179 AGTCATCAGTGTCTTTGTTGTGG - Intergenic
1044807709 8:96025017-96025039 AGTCATCTTTCTACTTCTTGTGG - Intergenic
1045320096 8:101075842-101075864 TGTCATGGCTCTGCTTGTTCTGG - Intergenic
1046383639 8:113481144-113481166 AGTGATCAGTCTGTTGGTTGTGG + Intergenic
1046903345 8:119545704-119545726 CGTCTTCACTGTGCTTGTGGAGG + Intergenic
1047942573 8:129839799-129839821 AGTTCACACTCTGCATGTTGAGG - Exonic
1048114777 8:131509351-131509373 AGAAATCTTTCTGCTTGTTGAGG - Intergenic
1050718674 9:8560149-8560171 AGTAATCATTCTGCTTTTTGTGG + Intronic
1053453305 9:38211388-38211410 AGTGGTCCCTCTGGTTGTTGGGG - Intergenic
1053754649 9:41293246-41293268 AGTCATCACTGTGCTTCTTCAGG - Intergenic
1054260170 9:62857550-62857572 AGTCATCACTGTGCTTCTTCAGG - Intergenic
1054331596 9:63762455-63762477 AGTCATCACTGTGCTTCTTCAGG + Intergenic
1056282143 9:85051934-85051956 AGTCATATCTCTGCCTGTGGTGG - Intergenic
1057231356 9:93323545-93323567 AGGCATCACTGTGCTGGTGGTGG + Intronic
1057236739 9:93367078-93367100 AGGCATCACTGTGCTGGTGGTGG - Intergenic
1057274084 9:93667067-93667089 AGTCATCACTCTGCTGCGCGAGG - Exonic
1202798966 9_KI270719v1_random:155369-155391 AGTCATCACTGTGCTTCTTCAGG + Intergenic
1186175324 X:6920533-6920555 AGTCATCCCTCTGCTCACTGAGG + Intergenic
1187915922 X:24151621-24151643 TGCCATCACTCTTCTAGTTGAGG - Intronic
1191979278 X:66908171-66908193 AGTCATCACAATGCTTGATTGGG + Intergenic
1198058193 X:133016293-133016315 AGTGATCACTCAGCTTGGTGGGG + Intergenic
1199085646 X:143627740-143627762 AGTAAGCACTCTGCTTATTTTGG + Exonic
1200055178 X:153456500-153456522 AGTCATCACTCTGCTTGTTGAGG + Exonic
1200395035 X:155980606-155980628 AGTCATCCCTCTGCTAACTGAGG + Intergenic
1202179692 Y:22129000-22129022 TGTCATCAGTCTCCTTGTGGAGG - Intergenic
1202211669 Y:22457394-22457416 TGTCATCAGTCTCCTTGTGGAGG + Intergenic