ID: 1200057733

View in Genome Browser
Species Human (GRCh38)
Location X:153470449-153470471
Sequence GGAGGTGTTCGGGAAGCTGA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 1, 2: 0, 3: 17, 4: 256}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200057733_1200057736 -10 Left 1200057733 X:153470449-153470471 CCTTCAGCTTCCCGAACACCTCC 0: 1
1: 1
2: 0
3: 17
4: 256
Right 1200057736 X:153470462-153470484 GAACACCTCCACAGCCGCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200057733 Original CRISPR GGAGGTGTTCGGGAAGCTGA AGG (reversed) Exonic
900421642 1:2558356-2558378 GGAGGCCTGCGGGGAGCTGACGG + Exonic
900487804 1:2931749-2931771 GGAGGTTTTGGGGAAGCAAAGGG + Intergenic
900763600 1:4488800-4488822 GGAGCTGGTGGGGAAGCTCATGG + Intergenic
900959652 1:5910787-5910809 GGATGGGTTCTGGAAGCTGCTGG - Intronic
901731269 1:11281657-11281679 GGAAGTGTTCTGGATGATGACGG - Intronic
901953803 1:12769923-12769945 GGAGGTGCTGGGCAGGCTGATGG + Intergenic
904059986 1:27701393-27701415 CCAGGAGTTTGGGAAGCTGAAGG + Intergenic
904469876 1:30729691-30729713 GGAGGTGCTCAGGAAGCAGCTGG - Intergenic
904873173 1:33634564-33634586 GGAGGCATTCAGGAAGATGAAGG - Intronic
905352869 1:37359662-37359684 GGAGGAGGTCTGGAAGCAGAGGG - Intergenic
905741278 1:40373727-40373749 GGAGGTGGTAGCGGAGCTGACGG + Exonic
907800327 1:57758541-57758563 TGAGGTGTTCAGAAAGCTCAGGG + Intronic
910838476 1:91539043-91539065 GGACCTGTTTGGGAAGCAGAAGG + Intergenic
910891080 1:92020901-92020923 GAAGGTCTTCAGGAAGCTAAAGG + Intergenic
911266900 1:95753658-95753680 GGAGGCCTTGGGGGAGCTGAGGG + Intergenic
911498892 1:98661896-98661918 GGAGGTGTTCAGCAAGGTGAGGG + Exonic
915068301 1:153244458-153244480 GGAGGTGGTGGGGTAGCTGTGGG + Intergenic
915079303 1:153340667-153340689 AGAGGGGTTTGGGAAGTTGAGGG - Intronic
915201687 1:154234599-154234621 GGAGATGGTCGGGAAGAAGAAGG + Exonic
915292980 1:154898721-154898743 CCAGGTATTCGGGAGGCTGAGGG - Intergenic
917672285 1:177284081-177284103 GGAGGTTTTCAGGAAGATGATGG + Intergenic
918248925 1:182684598-182684620 GGAGGGGGTGGGGAAGCAGAGGG + Intergenic
918689671 1:187465464-187465486 AGAGGTGCTTGGGAAGCTCATGG + Intergenic
920129828 1:203723616-203723638 GGAGGAGTTAGGGGAGCTGGTGG - Intronic
920342086 1:205281649-205281671 GTTGGAGTTCGGGAAGTTGAGGG + Intergenic
920372325 1:205486928-205486950 TGAGGTGTGAGGCAAGCTGAAGG - Intergenic
920685413 1:208105475-208105497 GGAGGAGTTAGGGAAACTGTGGG - Intronic
921494907 1:215827411-215827433 GGAGGAGTTTGGGAAGAAGAGGG + Intronic
921938320 1:220815101-220815123 GGACTTGTTGGGGAAGGTGATGG - Exonic
922618784 1:226978346-226978368 GGAGGTGTTCGGGTGGGTGGAGG - Intronic
1066757801 10:38728423-38728445 GGAAGTGTTCTGGAAGAAGAAGG + Intergenic
1067479098 10:46583986-46584008 GGTGGTGTGCAGGATGCTGAGGG - Intronic
1067615641 10:47757815-47757837 GGTGGTGTGCAGGATGCTGAGGG + Intergenic
1072452102 10:95546849-95546871 CCAGCTGTTCGGGAGGCTGAGGG - Intronic
1073513273 10:104055980-104056002 GGAGGAGGTGAGGAAGCTGAAGG - Exonic
1074543490 10:114385110-114385132 GGGTGTGATCGGGAAGGTGAAGG + Intronic
1075063288 10:119271871-119271893 GTAGGTACTCGGGAGGCTGAAGG + Intronic
1075596946 10:123738839-123738861 GGAGGTGTTGGGGTGGGTGAAGG - Intronic
1075857185 10:125639603-125639625 GGGGGGGTGGGGGAAGCTGAGGG + Intronic
1076216385 10:128697190-128697212 GGAGGTGCTCGGGAAGCTGAGGG - Intergenic
1076677338 10:132153912-132153934 GGAGCTGTTCAGTAAGCAGAAGG + Exonic
1077101641 11:825069-825091 GGAGGTGCTCGGGCAGCACAGGG - Exonic
1078397886 11:10998054-10998076 GGAGGTGTACAGGAACCTTATGG - Intergenic
1080796220 11:35566037-35566059 GGAGGTGTTAGGGAGCATGAAGG - Intergenic
1083773940 11:64884024-64884046 GGAGGTGTTCGCCCAGCAGAGGG - Intronic
1084568293 11:69943949-69943971 GGAGGTGCTGGGGGTGCTGAGGG + Intergenic
1084667181 11:70582756-70582778 GGTGGTGTTCTAGAAGCTGGCGG + Intronic
1084836528 11:71805714-71805736 GGAGGTTTTGGGGATGCTCAAGG + Intergenic
1088619862 11:111671031-111671053 GGAGGAGCTGGGGCAGCTGAAGG + Intronic
1088688385 11:112304281-112304303 GGAGGTGTTGGGGTGGTTGAGGG + Intergenic
1088894034 11:114064446-114064468 GGAGCTGTTCAGCAAGCTGGGGG + Exonic
1089966839 11:122660309-122660331 GGAGGTGTTCGGGAGGCATCAGG + Intronic
1090402290 11:126456578-126456600 GGTGGTCTTCAGGAAGCTGGGGG + Intronic
1090658666 11:128865012-128865034 GGAGGGGTGAGGGAAGCTGCAGG - Intronic
1092238282 12:6822903-6822925 GGGGGTGCTAGGGAACCTGAAGG - Intronic
1092402712 12:8190392-8190414 GGAGGTTTTGGGGATGCTCAAGG - Intergenic
1094373412 12:29763730-29763752 GGAGGATTTCAGGAAGCTCAAGG + Intronic
1095675651 12:44914722-44914744 GGAGGTGTTGGGAAAGCTATTGG + Intronic
1096180818 12:49549454-49549476 GGTGGTGTTTGGGAACGTGACGG + Exonic
1096732422 12:53625455-53625477 AGAGGTGTTTGGGAAGGAGATGG - Intronic
1100453942 12:94733690-94733712 GGGGGTGTTCTGGATGCTGTGGG - Intergenic
1101278883 12:103229418-103229440 GGTTGTGTTTGGGAAGGTGAGGG + Intergenic
1101962789 12:109262358-109262380 GGTGGTGTTCTGGAACCAGAGGG + Exonic
1102011951 12:109624301-109624323 GGGGGTGTTGGGGAGGCCGAGGG + Intergenic
1102430914 12:112882117-112882139 GAAGGTGTTCGAGCAGATGAAGG - Intronic
1103708650 12:122895254-122895276 AGATGGGTTCGGGAGGCTGAGGG - Intronic
1104891754 12:132143703-132143725 GGGGGGGTTCGGGAAGAGGAAGG - Exonic
1105506243 13:21012746-21012768 GGAGCTGTGCGAGAAGCTGTGGG + Intronic
1105576602 13:21658908-21658930 GGAGGTGTCAGGGAAGCAGCTGG + Intergenic
1109170143 13:59085062-59085084 TGAGGTGTTAGTGATGCTGATGG - Intergenic
1117149586 14:52871965-52871987 AGAGGTGTTGGGGAAGGGGAAGG + Intronic
1117336373 14:54760234-54760256 GGTGGTGCTCGGGGAGCTGTAGG - Exonic
1118229892 14:63938100-63938122 GGAGGAATTCGAGAAACTGAGGG + Intronic
1118893913 14:69930306-69930328 TGAGGTGATCCGGCAGCTGACGG - Intronic
1119609530 14:76050028-76050050 TGAGGTGTTCGGAAAACAGAAGG - Intronic
1119633698 14:76256846-76256868 GTGGGTGTTGGGGAGGCTGATGG - Intergenic
1122858035 14:104569253-104569275 GAAGGTATTGGGGAGGCTGAGGG - Intronic
1123050793 14:105541020-105541042 GGAGGAGTTGGGGAACCTGTGGG + Intergenic
1123094666 14:105761236-105761258 GGAGGTGTTCGGGCAGAGGCAGG + Intergenic
1124202066 15:27687059-27687081 GGAGGAGTTTGGGAGGCTGGAGG + Intergenic
1127142667 15:55993516-55993538 GGAGGTGTTCGGGCTCCTGGAGG - Intronic
1127957303 15:63864337-63864359 GGAGGAGTGAGGGAAGCAGAGGG + Intergenic
1128901441 15:71426063-71426085 GGAGGAGTTCGGGAGCCAGAAGG - Intronic
1129704312 15:77785730-77785752 GGAGGATTTGGGGAAGCTGGGGG - Intronic
1129823572 15:78620307-78620329 GGAGGTGGGCGGGATGCAGACGG + Intronic
1130066571 15:80609620-80609642 GGAGGCTTTCAGGATGCTGAGGG + Intergenic
1131667990 15:94590617-94590639 GAAGGTGATAGGGAAGCAGAAGG - Intergenic
1132115241 15:99131210-99131232 GGAGGTCATCGGGCAGCTGGAGG + Exonic
1132292049 15:100710592-100710614 GGAGGTGTTCGTACAGGTGATGG + Intergenic
1132387141 15:101408581-101408603 GGATGTGTTGGGGGAGGTGAGGG + Intronic
1132570903 16:643444-643466 GGAGGAGTTAGGGAAGAAGATGG + Intronic
1133563238 16:6968846-6968868 GCAGGTCTTCTGGCAGCTGAAGG + Intronic
1133876174 16:9736770-9736792 GGATGTTTTGGGGAAGCTGTAGG + Intergenic
1134678429 16:16106825-16106847 GGAGGAGACCTGGAAGCTGATGG + Exonic
1136368523 16:29821194-29821216 GGAGGTGATAGCGAGGCTGATGG + Intronic
1137491630 16:48937944-48937966 GGAGGTTTTCGTCAAGCAGAAGG - Intergenic
1141027385 16:80561086-80561108 GGAGGTGTAGGGGAAGGTCATGG - Intergenic
1141946695 16:87315611-87315633 GGAGGTGTTCTGGAGGCCCAGGG + Intronic
1143505435 17:7362099-7362121 GGAGGTGTTTGGGCAGCTACAGG + Intergenic
1144772241 17:17766273-17766295 GGGGGTGTCTGGGAAGCCGAGGG + Intronic
1144948328 17:18981119-18981141 GGAGGTGAAGGGGAGGCTGAGGG + Intronic
1145060260 17:19728756-19728778 GGAGGTGGAAGGGAAGCTGAGGG - Intergenic
1146790411 17:35747707-35747729 GGAGGTGTGGGGGAGGCTGGAGG - Intronic
1147288276 17:39420738-39420760 TCAGCTGCTCGGGAAGCTGAGGG - Intronic
1147490237 17:40859247-40859269 GGATGTGTGCTGGAAGGTGAAGG + Intergenic
1147986587 17:44310604-44310626 GGAGCTGTTCTGGGAGCTGGAGG - Intronic
1148147165 17:45373269-45373291 GGAGGTGTTCTTAAAGATGAGGG - Intergenic
1148445348 17:47733847-47733869 GGAGGTGTCGGGGAAACTGAGGG + Exonic
1151545225 17:74788782-74788804 GGTGGTGGTCACGAAGCTGAGGG - Exonic
1151732112 17:75917767-75917789 GGAGGTCATCGGGAAGATGGAGG - Exonic
1152462388 17:80448431-80448453 GGAGGGGGTCTGGAAGCTGTTGG + Intergenic
1152832020 17:82503388-82503410 GTAGGTGGTCGGGTGGCTGACGG + Intergenic
1154157005 18:11951679-11951701 GGAGGAGTGCGGGAAGGAGATGG + Intergenic
1154981942 18:21509669-21509691 GGTGGTTTTGGGGAGGCTGAAGG - Intronic
1160906325 19:1453315-1453337 GGAGGTGCTGGAGCAGCTGAAGG + Exonic
1160935718 19:1593596-1593618 GGGGGTGGTCGGGGAGCTGGGGG - Intergenic
1163177730 19:15576175-15576197 GGAGGTATTTGAGAAGATGAGGG + Intergenic
1163241039 19:16064140-16064162 GGAGGTGGCTGGGATGCTGATGG + Intergenic
1163354182 19:16799057-16799079 GGAACTGCTCTGGAAGCTGATGG + Intronic
1163600550 19:18246810-18246832 CCAGCTGCTCGGGAAGCTGAGGG + Intronic
1165333532 19:35154444-35154466 GGAGGTGTTGAGGAAGGAGAAGG - Intergenic
1166015127 19:39973968-39973990 GGAGGTGTCCAGGAGGCTGCTGG + Intronic
1166720825 19:44994812-44994834 GGAGTTGTGGGGGTAGCTGATGG - Intergenic
1166751236 19:45164876-45164898 GGCGGTGTTCCAGAAGCAGATGG - Exonic
1167634945 19:50649003-50649025 GGAGATGCTGGGGAAACTGATGG + Intronic
925631095 2:5894410-5894432 GGATGTGTTCAGGAAGAGGAGGG - Intergenic
925720688 2:6823651-6823673 GGAGATGTTTGGGCACCTGATGG - Intergenic
927467283 2:23346972-23346994 TGAGATGTTCAGGAAGCTGAAGG + Intergenic
929575811 2:43050997-43051019 GGAGCTGTTTGTGAGGCTGATGG - Intergenic
930716179 2:54596087-54596109 GGAGGTGTTGGGGCAGCAGAGGG - Intronic
933811997 2:86038553-86038575 GGAAGTGTTTAGGAAGCAGAGGG - Intronic
934321111 2:91972864-91972886 GGAAGTGTTCTGGAAGAAGAAGG + Intergenic
936292071 2:111233922-111233944 GGAGGTATATGAGAAGCTGAGGG - Intergenic
936864248 2:117058604-117058626 AGAGATGTTAGGGGAGCTGATGG + Intergenic
937479045 2:122240453-122240475 GGAGGTGTTGGGGAGTCTGATGG - Intergenic
939308300 2:140437355-140437377 GGAGGTGTTGAGGGAGCTGCTGG - Intronic
943903435 2:193470230-193470252 GGAGGTCCTAGGGAAACTGAAGG + Intergenic
944888826 2:204095700-204095722 GGAGGTGTTTGGGGAGATGTTGG - Intergenic
945719225 2:213397917-213397939 GGAGGTGTTCAGTAAGCAGTTGG - Intronic
946149645 2:217755597-217755619 GTAGGTGTTCAGGAAGCTTGGGG - Intronic
946405380 2:219489479-219489501 GGAGGTGTGGGGGGAGATGAGGG - Exonic
947301958 2:228697704-228697726 GGAGGTATCAGGGAAGCTGCTGG + Intergenic
948813571 2:240498492-240498514 GGGGGTGTGCGGGCAGCTGTGGG + Intronic
948813582 2:240498526-240498548 GGGGGTGTGCGGGCAGCTGTGGG + Intronic
1172926778 20:38544580-38544602 CCAGGTACTCGGGAAGCTGAGGG - Intronic
1173259602 20:41421948-41421970 GGAGGCGTTCATGCAGCTGAGGG + Exonic
1173284250 20:41655952-41655974 GGAGGAGTTAAAGAAGCTGATGG + Intergenic
1174198347 20:48789261-48789283 GGAGATGTTGAGGAAGCAGATGG - Intronic
1174968978 20:55252723-55252745 GGAGGTGTTTCTGAAGCTAATGG - Intergenic
1175764971 20:61586061-61586083 GGTGGTGATGGGGAAGATGATGG + Intronic
1175825994 20:61936828-61936850 GGATGAGTTCAGGGAGCTGACGG - Exonic
1176412266 21:6455433-6455455 GGAGGTGTTTGGGAAGACAAGGG - Intergenic
1177659036 21:24058310-24058332 GGAGGTGGTTGGGAAGTGGATGG - Intergenic
1178724160 21:35036459-35036481 GGAGGGGTTCGGCATGCTGAAGG - Intronic
1179069651 21:38059758-38059780 GGAGGTGTTGAGGAGGCTGGTGG + Intronic
1179576119 21:42309653-42309675 GGGGATGTTCGGGAATCTGTGGG - Intergenic
1179687760 21:43063755-43063777 GGAGGTGTTTGGGAAGACAAGGG - Intronic
1180798042 22:18617109-18617131 GGAGGTATGCAGGAAGCGGATGG + Intergenic
1181108776 22:20589649-20589671 GGGGGTGAACGGGCAGCTGAAGG - Intergenic
1181223676 22:21378158-21378180 GGAGGTATGCAGGAAGCGGATGG - Intergenic
1181255073 22:21557463-21557485 GGAGGTATGCAGGAAGCGGATGG + Intronic
1181723016 22:24790595-24790617 GGAGCTACTCGGGAGGCTGAGGG - Intergenic
1181804628 22:25367316-25367338 GGAGGAGCTGGGGAGGCTGATGG - Intronic
1183747343 22:39699208-39699230 GGAGGTGATGGGGGAGGTGATGG - Intergenic
1185078615 22:48696640-48696662 GCAGGTGTCCAGGCAGCTGATGG + Intronic
1185115342 22:48931597-48931619 GGAGGTGGCTGGAAAGCTGATGG + Intergenic
950284261 3:11732460-11732482 GGAGGTGTTGGGGAAGAGGTGGG + Intergenic
951913760 3:27777919-27777941 GGGGGTGGTCAGGAAGCAGAAGG + Intergenic
952258348 3:31714708-31714730 GGAGGTGTCCGGGAACTTGCAGG - Intronic
952260826 3:31738485-31738507 GGAGGGGGTTGGGGAGCTGAGGG + Intronic
954709651 3:52499167-52499189 GGAGGTGTTTGGGAGGCTTTGGG - Intronic
956530669 3:70214551-70214573 GCAGGTGTTGGGGAAGCTTGGGG - Intergenic
956777549 3:72577962-72577984 AGAGGGGTTTGGGAAGGTGAAGG - Intergenic
961656525 3:128445483-128445505 GGAGGTGATGGGGATGGTGATGG + Intergenic
961656553 3:128445618-128445640 GGAGGTGGTAGGGATGATGATGG + Intergenic
963880721 3:150525242-150525264 CCAGCTATTCGGGAAGCTGATGG + Intergenic
965292345 3:166899601-166899623 GGAGGGATTTGGTAAGCTGATGG - Intergenic
967378085 3:188827853-188827875 GCAGGTGGTCGGGAAGCAGATGG - Intronic
968975689 4:3821056-3821078 GGACAGGCTCGGGAAGCTGAAGG + Intergenic
969582484 4:8073221-8073243 GGTGGTGTGCGGGAAGCAGCAGG + Intronic
975435149 4:74343481-74343503 GGAGGTGTTTGGGTCACTGAGGG - Intergenic
978431232 4:108635123-108635145 GGAGGAGGTCCTGAAGCTGAGGG + Intergenic
980397476 4:132233032-132233054 GAAGGTCTTGGGGAATCTGAAGG + Intergenic
987536383 5:19194379-19194401 GGTGGTGTTGGTGAGGCTGATGG - Intergenic
990169542 5:53032852-53032874 GGGAGTGGTGGGGAAGCTGAGGG - Intronic
990348739 5:54894651-54894673 GGAGAAGTTCTGGAAGCTGATGG + Intergenic
991457366 5:66818760-66818782 GGAGGTGTTCAGGAACATGGCGG + Intronic
992068422 5:73128178-73128200 GGAGGGGTTCGGGAGGAGGAAGG - Intronic
992486367 5:77200971-77200993 GGAGGTGCTCTGGAAGCTTGTGG - Intergenic
992678882 5:79133538-79133560 GGAAGGGTTGGGGAAGCTGGGGG + Intronic
993152576 5:84179751-84179773 GTAGGTGTTCAGCAAGCAGAGGG - Intronic
995750789 5:115451588-115451610 GCAGGTGTTGGAGAAGCTGAAGG + Intergenic
997283161 5:132661177-132661199 GGAGCTCTTCGGGAGGCTGGTGG + Intergenic
999388234 5:151170864-151170886 GGTGGTGATTGAGAAGCTGATGG + Intergenic
1000686443 5:164255413-164255435 GGAAGTCTTCTGGATGCTGAGGG - Intergenic
1003074137 6:2968905-2968927 GGTGGTGTTCTGGAAGGAGATGG + Intronic
1004150960 6:13119758-13119780 GGAAGTGTTCCTGGAGCTGAAGG - Intronic
1008285090 6:49639889-49639911 GGAGGTATTTAGGAAGATGAAGG + Intergenic
1010792109 6:80076256-80076278 GGAAGAGTTAAGGAAGCTGAGGG - Intergenic
1011632847 6:89344392-89344414 GGAGGTTTTAGTGAAGCTGAAGG - Intronic
1012587814 6:100945489-100945511 GGAGGTGGTAAGGTAGCTGATGG - Intergenic
1013291080 6:108719348-108719370 GGGTGAGTTCAGGAAGCTGAGGG - Intergenic
1013601271 6:111707299-111707321 GAAGGTGTTCAGTAGGCTGAAGG - Intronic
1017237838 6:152135858-152135880 GGAGGTGGTCAGGAACCAGATGG - Intronic
1018699603 6:166416147-166416169 GGAGGTGGTGGTGAAGATGATGG - Intronic
1018699619 6:166416218-166416240 GGAGGTGGTGGTGAAGATGATGG - Intronic
1022427989 7:30285656-30285678 GCTGCTGTTCGGGATGCTGAAGG - Exonic
1022470416 7:30678670-30678692 GGAGATGTTCAGGAAGCAGCTGG - Intronic
1022698052 7:32728836-32728858 GCTGCTGTTCGGGATGCTGAAGG - Intergenic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1023868593 7:44250913-44250935 GGAGTTGATGGGGAAACTGAAGG - Intronic
1024217396 7:47259047-47259069 TGAGGTGTGGGTGAAGCTGAAGG - Intergenic
1024526361 7:50353353-50353375 GGAGGTGTTAGGGCAGGGGAAGG - Intronic
1026513886 7:71049923-71049945 GGAGGGGTTGGGGCAGCTGTTGG - Intergenic
1027231995 7:76278137-76278159 GTATGTGTTAGGGGAGCTGATGG + Intronic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1030532943 7:110732898-110732920 CTAGCTGTTTGGGAAGCTGAGGG - Intronic
1030975274 7:116114526-116114548 AGAGATGTTCTGGATGCTGAGGG + Intronic
1031375097 7:121014764-121014786 GGAGGTGGTGGAGAAGATGAGGG - Intronic
1032080997 7:128858385-128858407 GGAGGTGTACGTGAAGCACATGG + Exonic
1032091251 7:128912775-128912797 GGAGGTGTACGTGAAGCACATGG - Intergenic
1033366345 7:140674727-140674749 GGAGGAATTTGAGAAGCTGATGG + Exonic
1034316439 7:150137407-150137429 GCAGGTGCTCGGGAAACTGAGGG + Intergenic
1034453291 7:151149432-151149454 GGGGGTGGTGGGGAAGTTGAGGG - Intronic
1034790425 7:153963270-153963292 GCAGGTGCTCGGGAAACCGAGGG - Intronic
1036275387 8:7347197-7347219 GGAGGTTTTGGGGATGCTCAAGG + Intergenic
1036345965 8:7963154-7963176 GGAGGTTTTGGGGATGCTCAAGG - Intergenic
1036841293 8:12123906-12123928 GGAGGTTTTGGGGATGCTCAAGG - Intergenic
1036863098 8:12370159-12370181 GGAGGTTTTGGGGATGCTCAAGG - Intergenic
1037281698 8:17248377-17248399 GGAGGGGTGTGGGGAGCTGAGGG - Intronic
1037482533 8:19317648-19317670 GGAGGAAGACGGGAAGCTGAAGG + Intronic
1037666898 8:20977585-20977607 GGAGTTTCTCGGGAAGCTGGAGG - Intergenic
1037686606 8:21144891-21144913 GAAGGTTTTCAGGAAGCTGGAGG - Intergenic
1038235570 8:25750089-25750111 CCAGGTATTCAGGAAGCTGAGGG + Intergenic
1038917881 8:32046804-32046826 GGAGGTTTTGGGGGAACTGATGG + Intronic
1039189299 8:34953837-34953859 GGAGGTGCGCGGGAAGATGGTGG - Intergenic
1042736240 8:71992585-71992607 GGGGGTGTTTGGGAACCTGATGG + Intronic
1044738691 8:95304048-95304070 GGAGGTGAAAGGGAAGGTGAAGG + Intergenic
1046311612 8:112444708-112444730 GGGAGAGTTGGGGAAGCTGATGG + Intronic
1047355706 8:124119600-124119622 GGAGGTGTCTGGGCGGCTGAGGG - Exonic
1049401162 8:142427981-142428003 GGAGGTGGTGCTGAAGCTGATGG - Intergenic
1050207502 9:3212636-3212658 GGAGGTGTTTGGGGAGGTGTGGG + Intergenic
1050926574 9:11270370-11270392 GGAGGTCCTGGGGAAACTGAAGG - Intergenic
1051398469 9:16653576-16653598 GGAAGTGTTTGGGAAACAGAAGG + Intronic
1052227092 9:26103071-26103093 GGAGGTGTACTGAGAGCTGAAGG + Intronic
1054950911 9:70850472-70850494 GGAGGTGTTGGGTAAGTTTATGG + Intronic
1055074064 9:72195743-72195765 GAAGGTATACAGGAAGCTGAAGG + Intronic
1056058819 9:82860983-82861005 GGTGATCTTGGGGAAGCTGAAGG + Intergenic
1056431481 9:86532684-86532706 GGAGCTGTCAAGGAAGCTGAAGG + Intergenic
1057337441 9:94166643-94166665 GGAGCTGGGCGGGAAGCGGAGGG - Intergenic
1057405959 9:94771056-94771078 GGAAGTGGTATGGAAGCTGATGG + Intronic
1060662558 9:125413001-125413023 GGAGGTGTGAGGGTTGCTGAAGG + Intergenic
1061217647 9:129231149-129231171 GGACTTGTTCCTGAAGCTGAGGG + Intergenic
1061438280 9:130580088-130580110 GGAGGGGTCCGGGAAGCCCACGG + Intronic
1062144294 9:134980391-134980413 GGCGGTGTCCGGAAAGCTGCAGG + Intergenic
1062255512 9:135619008-135619030 GGAGGTGGAAGGGAGGCTGAGGG - Intergenic
1062532220 9:137006999-137007021 GCAGGTGGACGGGAAGATGAAGG + Intergenic
1062562778 9:137149208-137149230 GAAGGTGCTTTGGAAGCTGAAGG - Intronic
1185642017 X:1593609-1593631 GGAGGTGATGGAGAGGCTGAAGG + Exonic
1188231918 X:27674660-27674682 GCAGGGGTTCAGGAATCTGAAGG + Intronic
1188443513 X:30234180-30234202 GGAAGTGTTCAGGGAGATGAGGG + Intronic
1188528658 X:31113462-31113484 GGAGCTGTTGAGGAAGCTGCTGG + Intronic
1188879210 X:35471353-35471375 GGAGGTGTGGGGGATTCTGATGG + Intergenic
1190560648 X:51682501-51682523 GGAGACGTTCAGGAAGCTGCGGG - Intergenic
1190563643 X:51710820-51710842 GGAGACGTTCAGGAAGCTGCGGG + Intergenic
1193468537 X:81874010-81874032 GGAGGTGCTGGGGCAACTGAGGG - Intergenic
1196978879 X:121189816-121189838 GGAGATGTTTGGGAAGCAGGAGG - Intergenic
1198055369 X:132989607-132989629 GGAGGTGGCAGGGAAGATGAAGG - Intergenic
1198116403 X:133549202-133549224 GGCGGTGGTGGGGAAGCTGAAGG - Intronic
1200057733 X:153470449-153470471 GGAGGTGTTCGGGAAGCTGAAGG - Exonic
1200252839 X:154562875-154562897 GGAGGTGATCGATAAGCTGAAGG + Exonic
1200264928 X:154641541-154641563 GGAGGTGATCGATAAGCTGAAGG - Intergenic
1201188598 Y:11427986-11428008 GGAAGTGTTCTGGAAGAAGAAGG + Intergenic