ID: 1200063502

View in Genome Browser
Species Human (GRCh38)
Location X:153494237-153494259
Sequence AGAGTGGTTCTCATGTCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200063491_1200063502 25 Left 1200063491 X:153494189-153494211 CCGTAAGTGACCAGCACAGGGCT No data
Right 1200063502 X:153494237-153494259 AGAGTGGTTCTCATGTCCGAGGG No data
1200063488_1200063502 27 Left 1200063488 X:153494187-153494209 CCCCGTAAGTGACCAGCACAGGG No data
Right 1200063502 X:153494237-153494259 AGAGTGGTTCTCATGTCCGAGGG No data
1200063486_1200063502 28 Left 1200063486 X:153494186-153494208 CCCCCGTAAGTGACCAGCACAGG No data
Right 1200063502 X:153494237-153494259 AGAGTGGTTCTCATGTCCGAGGG No data
1200063490_1200063502 26 Left 1200063490 X:153494188-153494210 CCCGTAAGTGACCAGCACAGGGC No data
Right 1200063502 X:153494237-153494259 AGAGTGGTTCTCATGTCCGAGGG No data
1200063495_1200063502 -1 Left 1200063495 X:153494215-153494237 CCCAGAGGAAGTGGCCACCCACA No data
Right 1200063502 X:153494237-153494259 AGAGTGGTTCTCATGTCCGAGGG No data
1200063492_1200063502 15 Left 1200063492 X:153494199-153494221 CCAGCACAGGGCTGAGCCCAGAG No data
Right 1200063502 X:153494237-153494259 AGAGTGGTTCTCATGTCCGAGGG No data
1200063496_1200063502 -2 Left 1200063496 X:153494216-153494238 CCAGAGGAAGTGGCCACCCACAG No data
Right 1200063502 X:153494237-153494259 AGAGTGGTTCTCATGTCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200063502 Original CRISPR AGAGTGGTTCTCATGTCCGA GGG Intronic