ID: 1200066102

View in Genome Browser
Species Human (GRCh38)
Location X:153504760-153504782
Sequence CGCTGACACCTCGGGCGTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 90}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200066094_1200066102 23 Left 1200066094 X:153504714-153504736 CCCTGGACGATGGGCCATTCATG 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1200066102 X:153504760-153504782 CGCTGACACCTCGGGCGTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 90
1200066095_1200066102 22 Left 1200066095 X:153504715-153504737 CCTGGACGATGGGCCATTCATGA 0: 1
1: 0
2: 0
3: 1
4: 59
Right 1200066102 X:153504760-153504782 CGCTGACACCTCGGGCGTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 90
1200066097_1200066102 9 Left 1200066097 X:153504728-153504750 CCATTCATGATGAACGATGAGGA 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1200066102 X:153504760-153504782 CGCTGACACCTCGGGCGTCCTGG 0: 1
1: 0
2: 0
3: 3
4: 90

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200066102 Original CRISPR CGCTGACACCTCGGGCGTCC TGG Exonic
900346919 1:2214521-2214543 CTCTGACATCTCGGGCCTGCTGG - Intergenic
900364019 1:2303331-2303353 CGCTGACACTGCGGGGGACCAGG - Exonic
910805802 1:91188898-91188920 CCCTGACACCTTGCGCTTCCTGG + Intergenic
910915084 1:92279662-92279684 CGCTGACCCCTCGCACTTCCCGG - Intronic
914538586 1:148589806-148589828 CACTGCCACCTCTGCCGTCCGGG + Intronic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1062847701 10:720343-720365 CGTTCCCACCTCGGGTGTCCAGG + Intergenic
1064254526 10:13732685-13732707 CTCTGCCACCTCGAGCCTCCAGG - Intronic
1065054887 10:21834533-21834555 CCCTGACCCCTTGGGCTTCCAGG - Intronic
1067831003 10:49610955-49610977 CTCCCACACCTCGGGAGTCCGGG - Exonic
1069259900 10:66382138-66382160 CGCTGACCCCTTGTGCTTCCCGG - Intronic
1073124291 10:101140177-101140199 CGCTGGGGCCTGGGGCGTCCGGG + Intergenic
1077090992 11:778038-778060 TGGGGACACCTCGGGCGTGCTGG + Intronic
1077697402 11:4406720-4406742 CCCTGACCCCTTGGGCTTCCTGG + Intergenic
1083513757 11:63236571-63236593 CGCTGACCCCTTGTGCTTCCTGG + Intronic
1086117288 11:83266313-83266335 CGCTGACCCCTTGCGCTTCCAGG - Intronic
1087505903 11:99020830-99020852 CGGTGACAGCGCGGGCGGCCGGG + Intergenic
1087616165 11:100488903-100488925 CCCTGACCCCTTGGGCTTCCTGG - Intergenic
1091694042 12:2616217-2616239 AGCTGAAACCTCGGGAGGCCTGG + Intronic
1094677634 12:32636455-32636477 CACTGACACCTCCGCCGCCCAGG - Intronic
1098421748 12:70305099-70305121 CCCTGACCCCTTGGGCTTCCCGG + Intronic
1098638541 12:72813497-72813519 CCCTGACCCCTTGGGCTTCCCGG + Intergenic
1101440825 12:104703244-104703266 AGCTGACACCTCGGGCCTCTCGG + Intronic
1101827408 12:108231246-108231268 CACTGAGACCTGGGGCCTCCAGG + Intronic
1102211253 12:111128819-111128841 CACTGACACCTCGGGCACCATGG + Intronic
1102626093 12:114236533-114236555 GGCTGAGGCCTCAGGCGTCCAGG + Intergenic
1112232353 13:97602050-97602072 CCCTGACACCTTGCGCTTCCTGG - Intergenic
1113494329 13:110715094-110715116 CTCTGACACCCGGGGCGGCCAGG - Exonic
1113930750 13:113967700-113967722 CTCTGAGAACTCGGGCCTCCAGG + Intergenic
1117120987 14:52568185-52568207 CCCTGACCCCTTGGGCTTCCCGG - Intronic
1118677992 14:68209398-68209420 GGGTGACACCTCTGGCTTCCAGG + Intronic
1122910820 14:104826860-104826882 GGCGGAGACCTCGGGCGCCCCGG + Intergenic
1123983252 15:25622420-25622442 CGCTGACCCCTGGGGCACCCAGG - Intergenic
1125984689 15:44038735-44038757 CCCTGACCCCTCGTGCTTCCCGG - Intronic
1132398994 15:101493574-101493596 CACTGCAACCTCTGGCGTCCGGG + Intronic
1137800056 16:51254832-51254854 CCCTGACACCTTGTGCTTCCTGG + Intergenic
1138490539 16:57373709-57373731 CGCAGACACCTCAGGCTTCAGGG - Intronic
1138562537 16:57810509-57810531 CGCTGACACCACCAGCTTCCAGG + Intronic
1140519196 16:75566935-75566957 CGCTGTCACCTCTGTCGTCTGGG + Intronic
1142644059 17:1300765-1300787 CACTGACCCCTCTGGCCTCCAGG - Exonic
1147705337 17:42421928-42421950 CGCTGGCACCCTGGGCCTCCTGG - Intronic
1148711283 17:49683148-49683170 CACTGCCACCTCGGGCTCCCAGG + Intergenic
1149833666 17:59893341-59893363 CCCTGTCACCTCGGGCCCCCGGG - Intronic
1150481893 17:65517154-65517176 AGCTGAGACTTCGGGGGTCCTGG - Intergenic
1150654402 17:67030602-67030624 GGCTGAGACCGTGGGCGTCCTGG + Exonic
1151795613 17:76343297-76343319 GGCTGACACCTGGGGAATCCTGG - Intronic
1159140763 18:64391181-64391203 CACTAACACCTAGGGGGTCCTGG - Intergenic
1160681375 19:413068-413090 AGCTGATACCTGGGGCATCCTGG + Intergenic
1161438887 19:4279576-4279598 CGCTGAGAACCCAGGCGTCCGGG + Exonic
928305389 2:30166128-30166150 CACTGACACCTCTGGCAGCCAGG + Intergenic
932865388 2:75335981-75336003 CGCTGACAACTCTGGCATTCAGG - Intergenic
935196805 2:100820816-100820838 CTCCGAAACGTCGGGCGTCCTGG + Intronic
936147186 2:109987767-109987789 CGTTGTCACCTCGGTCGTCAGGG + Intergenic
936197506 2:110383716-110383738 CGTTGTCACCTCGGTCGTCAGGG - Intergenic
936328151 2:111523248-111523270 CCCTGAGACCTCGGAGGTCCCGG - Intergenic
943639541 2:190343642-190343664 CGCTGCCGCCTCGGGGCTCCCGG - Exonic
945409094 2:209488165-209488187 CCCTGACCCCTCGTGCTTCCTGG - Intronic
948187154 2:236030453-236030475 CTCTGAGACCTGGGGCCTCCCGG + Intronic
948945805 2:241218217-241218239 CGCTGACCCCTCCGGCGCCCAGG + Exonic
1175888413 20:62305000-62305022 CACTGACACCCCTGGCCTCCAGG - Intronic
954802790 3:53196749-53196771 CTCTGACACCACAGTCGTCCGGG - Intergenic
955667296 3:61364198-61364220 CTCTGACACCTTGCGCTTCCTGG - Intergenic
955669732 3:61391301-61391323 CCCTGACCCCTTGGGCTTCCTGG - Intergenic
956243330 3:67154165-67154187 CCCTGACCCCTTGGGCTTCCTGG - Intergenic
957011345 3:75009154-75009176 CTCTGACCCCTTGGGCTTCCTGG + Intergenic
963070500 3:141301378-141301400 CCCTGACCCCTCGCGCTTCCCGG + Intergenic
966583186 3:181591355-181591377 CCCTGACTCCTTGGGCTTCCCGG + Intergenic
969675912 4:8614284-8614306 GGCTGACACCCCTGACGTCCCGG + Intronic
979272899 4:118783040-118783062 CCCTGACCCCTTGGGCTTCCCGG + Intronic
982299029 4:153859991-153860013 CCCTGACACCTTGTGCTTCCCGG + Intergenic
985129235 4:186724476-186724498 CGCTGACACCCCGGACGCCCAGG + Intronic
988568602 5:32342008-32342030 TGCTGACATGTCGGGCTTCCGGG + Intergenic
991535638 5:67666760-67666782 CTCTGACCCCTTGGGCTTCCTGG + Intergenic
993008857 5:82457452-82457474 CCCTGACCCCTTGGGCTTCCCGG + Intergenic
1003024005 6:2537413-2537435 CGCTGCCACCTCAGCCTTCCAGG + Intergenic
1003128850 6:3378006-3378028 AGCAGACACCTCGGGACTCCTGG - Intronic
1010221106 6:73449917-73449939 CGCTGCAACCTCCGGCTTCCAGG - Intronic
1011949828 6:92952070-92952092 CCCTGACCCCTTGGGCTTCCTGG - Intergenic
1012129360 6:95471613-95471635 CCCTGACTCCTCGTGCCTCCTGG - Intergenic
1017708310 6:157145008-157145030 CGCAGACACCTCGGGTGCGCTGG - Intronic
1019419813 7:945768-945790 CTGAGTCACCTCGGGCGTCCTGG - Intronic
1019500185 7:1360766-1360788 CGCTGAGCCCTTGGGCGGCCCGG - Intergenic
1024205821 7:47159875-47159897 CCCTGACCCCTTGGGCTTCCTGG - Intergenic
1031435292 7:121725262-121725284 CCCTGACTCCTTGGGCTTCCTGG + Intergenic
1031651071 7:124290709-124290731 CACTGAAACCTCGAGCTTCCGGG + Intergenic
1034437981 7:151072164-151072186 CCCTGAGACCTCGGCCCTCCTGG - Intronic
1044548343 8:93483987-93484009 GACTGACACCTCCTGCGTCCGGG + Intergenic
1049693753 8:143973739-143973761 CGCCGACACCGCGGTCGCCCGGG + Intronic
1052799998 9:32957990-32958012 CCCTGACCCCTTGGGCTTCCTGG - Intergenic
1061309051 9:129750580-129750602 CGCTGACACTGGGGGCTTCCTGG - Intronic
1190284322 X:48951978-48952000 CGCTGCAACCTCCGGCTTCCGGG - Intronic
1191830266 X:65407799-65407821 CGCGGAGACGTCGGGCGTTCGGG - Intronic
1191938670 X:66454040-66454062 CCCTGACACCTTGAGCTTCCTGG - Intergenic
1200066102 X:153504760-153504782 CGCTGACACCTCGGGCGTCCTGG + Exonic