ID: 1200066621

View in Genome Browser
Species Human (GRCh38)
Location X:153507110-153507132
Sequence TGTCCAAGTGGAGCTCCCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 78}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200066621_1200066625 -6 Left 1200066621 X:153507110-153507132 CCTCCGGGAGCTCCACTTGGACA 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1200066625 X:153507127-153507149 TGGACAACAACAAGTTGGCCAGG 0: 1
1: 0
2: 0
3: 10
4: 167
1200066621_1200066628 6 Left 1200066621 X:153507110-153507132 CCTCCGGGAGCTCCACTTGGACA 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1200066628 X:153507139-153507161 AGTTGGCCAGGGTGCCCTCAGGG 0: 1
1: 0
2: 1
3: 9
4: 185
1200066621_1200066627 5 Left 1200066621 X:153507110-153507132 CCTCCGGGAGCTCCACTTGGACA 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1200066627 X:153507138-153507160 AAGTTGGCCAGGGTGCCCTCAGG 0: 1
1: 0
2: 3
3: 57
4: 295
1200066621_1200066626 -5 Left 1200066621 X:153507110-153507132 CCTCCGGGAGCTCCACTTGGACA 0: 1
1: 0
2: 0
3: 9
4: 78
Right 1200066626 X:153507128-153507150 GGACAACAACAAGTTGGCCAGGG 0: 1
1: 0
2: 1
3: 10
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200066621 Original CRISPR TGTCCAAGTGGAGCTCCCGG AGG (reversed) Exonic
903759786 1:25689848-25689870 TGTCCAAGCCGAGCACCAGGAGG - Intronic
903852828 1:26318460-26318482 TGTCCAAGTGGAGCCTGCTGTGG + Intronic
907983973 1:59512325-59512347 TTTCCAAGAGAAGCTCCAGGAGG - Exonic
911666200 1:100555996-100556018 TGTGGCAGTGGACCTCCCGGTGG - Intergenic
917510295 1:175663975-175663997 TGTCCAAGTGTGGGTCCCAGGGG + Intronic
1067962888 10:50876336-50876358 TGTCCAAGTGGAGCACAGGCTGG - Intronic
1069798917 10:71070359-71070381 TGTCCAGGTGGCTCTCCAGGCGG + Intergenic
1069966174 10:72119198-72119220 AGGCCAAGTAGAGCTCCTGGAGG - Intronic
1070828989 10:79407245-79407267 TGTCCCAGAGGAGCACTCGGTGG + Intronic
1074225677 10:111481826-111481848 TTTCCAAGTGGAGCTCTCACTGG - Intergenic
1076455282 10:130588484-130588506 TGTCCAAGTGGGGCTGCAAGGGG - Intergenic
1076931304 10:133533636-133533658 TGTCCAAGAGGCTCTCCCAGTGG - Intronic
1077107201 11:847418-847440 TATCTAATTGGAGCTCCCGTGGG + Intronic
1077179898 11:1207576-1207598 GGTCTCAGTGGAGCTACCGGTGG - Intergenic
1077314790 11:1913990-1914012 TGTCCATTTGGTGCTCCTGGGGG + Intergenic
1084154311 11:67305013-67305035 GGCCCATGTGGAGCTCCGGGGGG + Intronic
1085455850 11:76665003-76665025 GGTCCAAGAGGGGCTTCCGGAGG + Intronic
1091273167 11:134332063-134332085 TGACCACGTGGAGCCTCCGGCGG + Exonic
1091719040 12:2799125-2799147 TCTCAAAGCGGAGCTCCCGCTGG - Exonic
1092259718 12:6946388-6946410 GCTCCAGGTGGAGCTCCAGGTGG + Intergenic
1104425070 12:128669591-128669613 TGTCCAAGTGAAGTTCCCACCGG - Intronic
1104657093 12:130581466-130581488 TGTCCCAGTGGAGGTCTCAGAGG + Intronic
1104915318 12:132261486-132261508 TGTCCTGATGGAGCTCCCTGTGG + Intronic
1110294447 13:73846295-73846317 TGTGAAAGGGGAGCCCCCGGAGG - Exonic
1111392832 13:87621069-87621091 TGTCCAAGTGGAGGTGGAGGAGG - Intergenic
1112266941 13:97932916-97932938 TGTCCAAGTGAGGCTCCTGGAGG + Intergenic
1117252913 14:53953611-53953633 GGTCCGGGAGGAGCTCCCGGCGG + Intronic
1122374148 14:101247420-101247442 TCACCATATGGAGCTCCCGGGGG - Intergenic
1122504458 14:102222739-102222761 TGACCACGTGGAGCTGCTGGCGG + Intronic
1125756467 15:42068888-42068910 TGGCCAAGTGGATCTCACCGGGG - Exonic
1128347236 15:66862233-66862255 TGCCCAAGAGGAGCTCCCAGAGG + Intergenic
1130999828 15:88931088-88931110 AGTACAAGTGGGGCTCCTGGGGG + Intergenic
1133098979 16:3467590-3467612 GGTGCAAGTGGAGCACCCTGTGG + Intronic
1139787076 16:69402421-69402443 TGTCCAAGTTCAGCTTCAGGAGG + Intronic
1142246443 16:88972304-88972326 TGTGCCAGTGGAGCCTCCGGTGG + Intronic
1142681656 17:1553225-1553247 TGTCTAACTGGATCTCCCTGGGG + Intronic
1142882050 17:2889489-2889511 TCACCCAGTGGAGCTCCCGGCGG + Intronic
1143175973 17:4955326-4955348 TGCCCATGTGGAGATCCAGGGGG - Intronic
1152244846 17:79179936-79179958 CGCCCAAGTGGGGCTCCTGGAGG + Intronic
1155608230 18:27632685-27632707 TGTCCATTTGGAGCTCCCAGGGG - Intergenic
1159706470 18:71695651-71695673 TGTTCAAGTGGAGCACACAGGGG - Intergenic
1160755922 19:757180-757202 TCTCCGAGTGGAGCCCCCGTGGG - Exonic
1161026602 19:2039995-2040017 TGACTCAGTGAAGCTCCCGGTGG - Intronic
1164677568 19:30111964-30111986 TGCCCAAGTGGAGTGGCCGGAGG - Intergenic
1165923843 19:39314973-39314995 TGTCCAGGTGCAGGGCCCGGAGG + Exonic
1166107678 19:40605424-40605446 CGTCCACGTGGAGCACCCGCAGG + Exonic
926349751 2:11984092-11984114 TGTCCAAGTGCTGCTCCTGGTGG + Intergenic
934208209 2:89951545-89951567 TGTCCATGGGGAGCCTCCGGAGG - Intergenic
935924436 2:108052067-108052089 TGTGCAAGTGGAGAGCCCTGTGG - Intergenic
938422455 2:131155629-131155651 TGTCCACGTGGAGCCTCCTGAGG - Intronic
942329374 2:174805999-174806021 TGCCAAAGTTGAGCTCCCTGTGG - Intronic
945496411 2:210512020-210512042 TGTCCAACTTGAGCTGCCTGTGG - Intronic
947958111 2:234212608-234212630 TGTCCCACTGGGGCTCCAGGAGG + Intergenic
1172519489 20:35557727-35557749 TGCCCATGTGGGGCTCCCGAGGG - Intergenic
1172887641 20:38241791-38241813 CCTCCAAGTGGAGCCCCAGGAGG - Exonic
1175132341 20:56798755-56798777 TGTCCACTTGGAGATCCTGGAGG - Intergenic
1179104218 21:38383873-38383895 TGTCCGACAGGAGCTCCAGGAGG + Exonic
1179482648 21:41688209-41688231 TGTCCACCTGGAGTTCCCGATGG - Intergenic
1179709806 21:43206798-43206820 TGACCTAGTGGAGCTCGCTGGGG + Intergenic
1180183264 21:46127341-46127363 GTTCCATGGGGAGCTCCCGGTGG + Intronic
1181037893 22:20178668-20178690 TCTCCGAGTGGAGCTCCCGAGGG - Intergenic
1184460160 22:44633331-44633353 TGACCCAGGGGAGCTCACGGTGG - Intergenic
953718281 3:45334204-45334226 TCTCCAAGAAGAGCTCCAGGTGG + Intergenic
954765553 3:52912581-52912603 TGTCCAGCTGGAGCTCCCGAAGG + Exonic
954876013 3:53803647-53803669 AGCCCAAGTGCAGCTGCCGGTGG - Intronic
956170552 3:66430528-66430550 TGTCCACGTGGAACTCCCAGGGG - Intronic
956410019 3:68969393-68969415 TGTCCAAGTGAAGACCCCTGTGG - Intergenic
969646333 4:8431643-8431665 GGTCCACGTGCAGCTCCTGGTGG - Intronic
982206788 4:153002532-153002554 TGTATAAGTGGAGCTCCCATGGG - Intergenic
992086762 5:73284554-73284576 TGGCCAACTGGAGCTTTCGGAGG - Intergenic
999573548 5:152947696-152947718 TGTCAAAGTAGAGTTCCCTGTGG - Intergenic
1001406528 5:171481003-171481025 GGTCCCAGTGGAGCCCCAGGTGG - Intergenic
1002594937 5:180315900-180315922 TGTCCAAGCCGAGCTGCCTGTGG - Intronic
1017817973 6:158028686-158028708 TGTCCCCTTGGAGCTCCAGGCGG + Intronic
1026808449 7:73442799-73442821 AGACCAAGCGGAGCTCCCGGAGG - Exonic
1027676229 7:81161879-81161901 TGTCCATTTGGAGCTGCCGAAGG - Intergenic
1027848939 7:83424404-83424426 TTTCCAAATGGAGCTCTCTGTGG - Intronic
1028638052 7:93013284-93013306 TGTGCAAGTGAAGCACCCTGAGG - Intergenic
1037752481 8:21691934-21691956 TGCGTAAGTGGAGCTCCCAGTGG - Exonic
1044699093 8:94949852-94949874 TGACCAGGTGGGGCTCTCGGAGG - Intronic
1057359446 9:94359919-94359941 TGTCCCATTGGTGCTCCAGGAGG - Intergenic
1057648319 9:96897673-96897695 TGTCCCGGTGGTGCTCCAGGAGG + Intergenic
1061961700 9:133992060-133992082 TGTCCCAGGTGAGCGCCCGGCGG - Exonic
1203759671 EBV:5613-5635 TGTCCAGGGGGAGCACCCCGTGG - Intergenic
1187312143 X:18155432-18155454 TGTCCAAGCCCAGCTCCAGGAGG - Intergenic
1189195351 X:39147891-39147913 TCTCCATGTGGAGCACCCAGTGG + Intergenic
1200066621 X:153507110-153507132 TGTCCAAGTGGAGCTCCCGGAGG - Exonic
1201921612 Y:19239885-19239907 TGTCCTAGTGGAGATCCTGTGGG - Intergenic