ID: 1200072360

View in Genome Browser
Species Human (GRCh38)
Location X:153535524-153535546
Sequence CCGGAGGAAGGGTGGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 367
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 334}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200072360_1200072378 20 Left 1200072360 X:153535524-153535546 CCTGTTTCCCACCCTTCCTCCGG 0: 1
1: 0
2: 1
3: 31
4: 334
Right 1200072378 X:153535567-153535589 CTGGCCCCCCAGGTACTCTCAGG 0: 1
1: 0
2: 1
3: 15
4: 159
1200072360_1200072370 1 Left 1200072360 X:153535524-153535546 CCTGTTTCCCACCCTTCCTCCGG 0: 1
1: 0
2: 1
3: 31
4: 334
Right 1200072370 X:153535548-153535570 CCTCCTCCTTTCCTCGCCCCTGG 0: 1
1: 0
2: 1
3: 51
4: 518
1200072360_1200072379 21 Left 1200072360 X:153535524-153535546 CCTGTTTCCCACCCTTCCTCCGG 0: 1
1: 0
2: 1
3: 31
4: 334
Right 1200072379 X:153535568-153535590 TGGCCCCCCAGGTACTCTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 130
1200072360_1200072373 10 Left 1200072360 X:153535524-153535546 CCTGTTTCCCACCCTTCCTCCGG 0: 1
1: 0
2: 1
3: 31
4: 334
Right 1200072373 X:153535557-153535579 TTCCTCGCCCCTGGCCCCCCAGG 0: 1
1: 0
2: 3
3: 25
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200072360 Original CRISPR CCGGAGGAAGGGTGGGAAAC AGG (reversed) Intronic
902214381 1:14924874-14924896 CTGGGGGAAGCGTGGGAAAGGGG + Intronic
902259019 1:15210041-15210063 AGGGAGGAAGGGAGGGAGACGGG + Intronic
902625659 1:17674635-17674657 CCTGTGAGAGGGTGGGAAACTGG + Intronic
904797860 1:33070970-33070992 CTGGAGAAAGGCTGGGAAAATGG + Intronic
905207749 1:36352619-36352641 CAGGGGGAAGGGAGGGAAACAGG - Intronic
905276872 1:36824161-36824183 CTGGAGGCAGGGTGGGAAGAAGG + Intronic
905422758 1:37859632-37859654 CCGGAGGAAGGTGGGGACAGAGG + Intergenic
905656472 1:39689271-39689293 CAGAAGGCAGGGTGGGAACCAGG - Intronic
906114239 1:43345470-43345492 GCGGATGAAGGGTGATAAACTGG + Intronic
906781080 1:48573282-48573304 CAGTAGGGAGAGTGGGAAACTGG + Intronic
907638559 1:56161137-56161159 CCGGGGGATGGATGGAAAACTGG + Intergenic
908037750 1:60074042-60074064 TCGGAGGAAGGGCGGGACAAGGG - Intergenic
911163244 1:94702515-94702537 CCTGAGGAAGGCTGGGAACAAGG - Intergenic
912297084 1:108480506-108480528 CCAGAGGAGGGGTGGGAGATGGG - Intergenic
912972147 1:114293672-114293694 CTGGAGGAAGGCTGGGAAACTGG - Intergenic
913063448 1:115228499-115228521 ACGGAGAAAGGGAGGGAAAGAGG - Intergenic
913317225 1:117563476-117563498 CGGGAGTGAGGGTGGGAAGCGGG - Intergenic
914764311 1:150624511-150624533 CCAGAGGTAGGCTGGGAAAGTGG + Intronic
915061574 1:153190192-153190214 CTGTATGAAGGGTGGGAGACAGG - Intergenic
915275346 1:154784499-154784521 CCTGTGGAAGGGTGGGACGCTGG - Intronic
915325347 1:155079015-155079037 CCGGAGGGGCGCTGGGAAACCGG + Exonic
916885464 1:169063588-169063610 CAGGAGGTATGGTGGGAAAAAGG - Intergenic
917104650 1:171480281-171480303 CAGGAAGAAGGGAGGGAAAGAGG - Intergenic
917782306 1:178411394-178411416 TGGGAGGAAGGGTGGGAGATGGG + Intronic
917930859 1:179821579-179821601 CAGGAGGGAGGGAAGGAAACGGG + Intergenic
918066788 1:181106671-181106693 CCGCAGGAAGGGAAGGAAAAAGG + Intergenic
918317030 1:183331022-183331044 AGGAAGGAAGGGTGGGAAAAAGG - Intronic
918596989 1:186305948-186305970 CAGGAGGAAGGAAGGGACACTGG + Intronic
918802011 1:188984800-188984822 AGGGAGGAAGGGTGGGAGAGAGG - Intergenic
919105314 1:193142652-193142674 AAGGAGGAAGAGAGGGAAACGGG - Intronic
920111718 1:203591788-203591810 CTGGAGGAAGGGCTGGAAGCAGG + Intergenic
920684934 1:208102171-208102193 CTGGAGGGAGGGAGGGAAGCTGG - Intronic
921324896 1:213980229-213980251 CCGGAGGAGGCCCGGGAAACAGG - Intergenic
922801979 1:228368611-228368633 CCGGGGGCAGGGTGGGACAGTGG - Intronic
1062803431 10:396822-396844 CCGGTGGGGGGGGGGGAAACTGG + Intronic
1064063358 10:12158800-12158822 CTGGAGGCAGGGTGGGAGATAGG - Intronic
1064359968 10:14655691-14655713 CAGGAGGAGAGGTGGGAAGCCGG + Intronic
1064476698 10:15698055-15698077 TGGGAGAAAGGGTGGGAAAGGGG - Intronic
1065450159 10:25848421-25848443 AGGGAGGAAGGGAGGGAAAAGGG + Intergenic
1067158906 10:43806171-43806193 CTGGAGGAAGGGAGGGCAGCAGG - Intergenic
1067975859 10:51024750-51024772 CAGGAGGAAGAGAGGGAAACGGG + Intronic
1068532591 10:58206774-58206796 CTTGAGGAAGGGTGGGATGCAGG - Intronic
1069604631 10:69731669-69731691 GGGGAGAAAGGGTGGGAAGCAGG - Intergenic
1071137511 10:82469202-82469224 CGGAAGGAAGGGAGGGAAAAGGG - Intronic
1071274316 10:84038938-84038960 CCACAGGAAGGGTGGGAGATGGG + Intergenic
1071343755 10:84671966-84671988 CTGGAGGCAGGGAGGCAAACAGG - Intergenic
1072914713 10:99530816-99530838 CCGGAGGTGGGGTGGGGAAGTGG + Intergenic
1074495633 10:113977928-113977950 CCAGAGAAAGGATGGGAAAGGGG - Intergenic
1074609129 10:115004429-115004451 ACGGAGGGAGGGAGGGAAGCAGG - Intergenic
1075353182 10:121744780-121744802 CCACAGGAAGGCTGGGAAACAGG - Intronic
1075576803 10:123583786-123583808 GCGTCGGAAGGGTGGGAAAGCGG + Intergenic
1076857738 10:133125861-133125883 CAGGAGGAAAGGTGGGAGGCAGG - Intronic
1077272253 11:1686821-1686843 GAGGAGGAAGGGAGGGAAAGAGG - Intergenic
1077318473 11:1929556-1929578 CAGGAGGAAGGGTGAGGAAGAGG - Intronic
1079497730 11:21064652-21064674 ATGGAGGAAGGATGGGAAAGTGG + Intronic
1080348006 11:31347228-31347250 CTAGAGGAAGGGTGAGAAACAGG + Intronic
1082763653 11:57149464-57149486 AAAGAGGAAGGGTGGGAAACCGG + Intergenic
1083702640 11:64489932-64489954 CCGCAGGGAGTGTGGAAAACTGG - Intergenic
1085525073 11:77159397-77159419 GGGGAGGGAGGGTGGGCAACAGG - Intronic
1085993525 11:81881593-81881615 TTGGAAGAATGGTGGGAAACAGG - Intergenic
1087405802 11:97728462-97728484 TGGGAGGAAGGGTGGGAGAGGGG + Intergenic
1088801170 11:113308599-113308621 CCATAGGAAGGGTGTGGAACAGG - Intergenic
1090873313 11:130767155-130767177 CAGAAGGCAGGGTGGAAAACTGG + Intergenic
1091021229 11:132101971-132101993 CTGTAGGAATGGTGGGAAATGGG - Intronic
1091856703 12:3746391-3746413 GTGGAGGAAGGGTGGGGAAGAGG - Intronic
1094715322 12:33008198-33008220 AAGGAGGAAGGGAGGGAAAGAGG - Intergenic
1095160117 12:38905773-38905795 CCGGAAGGGGGCTGGGAAACCGG - Intronic
1095341988 12:41100807-41100829 CTGGGGAAAGGGTGTGAAACAGG - Intergenic
1095370851 12:41465698-41465720 CTGGAGGAAGGGAGAGAGACTGG - Intronic
1096072133 12:48781328-48781350 CCTGAGGCAGGGTGGGCAACAGG + Intronic
1096344806 12:50836438-50836460 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1097183507 12:57184204-57184226 CCGGAGAAAGGGTGAGGAGCTGG + Exonic
1099222862 12:79935037-79935059 CCAGAGGAGGGCTGGGAACCCGG + Exonic
1104789511 12:131472970-131472992 CCAGTGGAATGGTGGGAAATGGG + Intergenic
1104827500 12:131723754-131723776 CCAGAGGAGGCATGGGAAACAGG - Intronic
1105860701 13:24409463-24409485 GAGGAGGAAGGGTGGGAGATAGG + Intergenic
1106264057 13:28093904-28093926 AAGGAGGAAGGGTGGGAAGGAGG + Intronic
1113670278 13:112171275-112171297 CCAGAGCCAGGGTGGGAAAAAGG + Intergenic
1114707935 14:24746346-24746368 CAGGAGGTAGGGAGGGACACAGG + Intergenic
1115404444 14:32998881-32998903 CCAGAGCAAGGGTGAGCAACGGG - Intronic
1115421484 14:33199729-33199751 GGGGAGGAAGGGAGGGAAAGAGG - Intronic
1116674253 14:47885191-47885213 CAGGAGGAAGGGTGGGAGGCAGG - Intergenic
1118206423 14:63727809-63727831 CCGGAGGGAGGATGAGAAAGCGG - Exonic
1119176575 14:72572876-72572898 AAGGAGGGAGGGAGGGAAACAGG + Intergenic
1119184777 14:72632632-72632654 CAGGAGGAAGGGAGGGAAGGAGG + Intronic
1120089535 14:80315065-80315087 ACGAAGGAATGGTTGGAAACTGG - Intronic
1120163996 14:81174570-81174592 CCGGAAGAATGGTGTGAACCCGG + Intergenic
1120299752 14:82691571-82691593 CCAGAGGTAGGCTGGGAAAGTGG + Intergenic
1121036164 14:90705446-90705468 CCAGAGGCCGGGTGGGAATCAGG - Intronic
1125378306 15:39058113-39058135 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1128647173 15:69386580-69386602 CCGGAGGGTGGGAGGGAATCCGG - Intronic
1129163886 15:73764205-73764227 CAGGAGGAAGGGCGGGACAAGGG + Intergenic
1129265629 15:74391812-74391834 CCTGAGGAAGGAGGGGAGACAGG - Intergenic
1129814769 15:78541658-78541680 CCGGGGGTAGGGTGGGAAAAGGG - Intronic
1130235881 15:82132985-82133007 CAGGAGGAAGGGAGGGAAAGTGG + Intronic
1130386597 15:83417407-83417429 CCAGAGAAAGGCTGGGGAACAGG - Intergenic
1130558372 15:84939398-84939420 CCGAAGGAAGGGAGGGAGCCTGG + Intronic
1131029009 15:89170676-89170698 CTGGAAGAAGTGTGGGTAACAGG - Intronic
1131084708 15:89566619-89566641 GCTGAGGAAGGGTGGGAGATGGG - Intergenic
1132238488 15:100239597-100239619 CAGGAGGAAGTGTTGGAGACGGG + Intronic
1132706394 16:1245312-1245334 CCTGAGGAAGAATGGGAAGCGGG - Intergenic
1132709828 16:1261462-1261484 CCTGAGGAAGGGAAGGAAAGGGG + Intergenic
1133839271 16:9394057-9394079 AGGGAGGAAGGGAGGGAAGCAGG - Intergenic
1134468248 16:14498194-14498216 CCGGAGGAGAGGAGGGGAACTGG + Intronic
1136923464 16:34350606-34350628 CCGGAGGAAGGAAGTGAAACTGG - Intergenic
1136981109 16:35061200-35061222 CCGGAGGAAGGAAGTGAAACTGG + Intergenic
1137676657 16:50306986-50307008 CTGGAGGCAGGGTGGGCAAGTGG + Intronic
1138183000 16:54955478-54955500 CCGGAGGAGGGGTGAGGCACTGG + Intergenic
1138332650 16:56227398-56227420 CTGGAGACAGGGTGGGAACCAGG - Intronic
1139322667 16:66127932-66127954 CTGGAGGAAGGGTGGGGACCAGG + Intergenic
1139558739 16:67728709-67728731 CTGGGGCAAGGGTGGGAATCAGG - Intronic
1140242205 16:73213267-73213289 CTTGAGAAAGGTTGGGAAACGGG + Intergenic
1140410220 16:74736695-74736717 CCTGAGGAAGGATGGGGAAGAGG + Intronic
1142994020 17:3750511-3750533 GCGAGGGAAGGGAGGGAAACGGG + Intronic
1143015820 17:3890654-3890676 GGGGAGCAAGGGTGGGCAACAGG - Intronic
1146282608 17:31554744-31554766 CCTGGGAAAGGGTGGGAAGCAGG + Intergenic
1146750463 17:35373824-35373846 ACGGAGGAAGGGTGGGAAGAAGG - Intergenic
1147055730 17:37833444-37833466 CCGGTGGAAGGATGGGCCACAGG + Intergenic
1147765708 17:42834107-42834129 CAGGAGGAAGGGAGGGAAGGGGG + Intronic
1148000676 17:44385392-44385414 CCGGAGGAGGGCTGGGGGACAGG + Intronic
1148204936 17:45774283-45774305 CCGGAGCAAGGCTGGGAAGGAGG + Intergenic
1148210642 17:45806539-45806561 CTGGAGGAAGGGAGGGAAGTGGG + Intronic
1149557227 17:57582150-57582172 CTGGAGGTAGGGTGGGAACAGGG - Intronic
1149595579 17:57862735-57862757 CCGGGGGAAGGCTGAGATACAGG + Exonic
1149602940 17:57904781-57904803 GCCGAGGAAGGGTGGGAATGAGG - Intronic
1150553349 17:66231337-66231359 AGGGAGGAAGGGAGGGAAAAAGG - Intronic
1150914016 17:69417782-69417804 CCGGAGGGAGGGAGAGAAAGAGG + Intronic
1151566921 17:74903834-74903856 GGGGAGGTGGGGTGGGAAACCGG - Intergenic
1153994113 18:10424758-10424780 CCGGAGGGAGGGAGGGAGGCAGG + Intergenic
1155937812 18:31772373-31772395 CCGGGGGAAGGCTGGGAAGGGGG + Intergenic
1156075633 18:33275632-33275654 TTGGAGGAAGGGTAGGAAAGGGG + Intronic
1156798579 18:41079675-41079697 GAGGAGGAAGGGTGGGAAGGAGG - Intergenic
1157929691 18:51808107-51808129 CAGGATGAAGGGTGGGGCACTGG - Intergenic
1157994427 18:52538140-52538162 TCGGAGGAAGATTGGGATACAGG - Intronic
1158504112 18:58030832-58030854 CAGGAGGGTGGGTGGGAATCTGG + Intergenic
1159655477 18:71027050-71027072 CCAGAGGAAGGGCTGGGAACAGG - Intergenic
1160899206 19:1418717-1418739 CCGAAGGAAGGATGGGTAAGGGG + Exonic
1161267565 19:3371723-3371745 CAGAGGGAAGGGAGGGAAACTGG - Intronic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1163082591 19:14954432-14954454 CCGAAGAAAGGCTGGGGAACAGG + Intronic
1163477109 19:17532857-17532879 AGGGAGGAAGGGAGGGAAAGGGG + Intronic
1164731047 19:30504565-30504587 AAGGAGGAAGGGTGGGAGAGAGG - Intronic
1164731057 19:30504605-30504627 AGGGAGGAAGGGTGGGAGAGAGG - Intronic
1164952124 19:32345645-32345667 CCGGATGAGGAGGGGGAAACCGG + Exonic
1166329599 19:42070262-42070284 CAGGAGGAAGGGAGGGAGGCAGG + Intronic
1166497684 19:43316066-43316088 CCGGAGGAGGAGTGGGAGGCGGG + Intergenic
1166853032 19:45769329-45769351 CGGGAGGAGGGGCGGGGAACGGG + Intergenic
1167294021 19:48639059-48639081 GTGGAAGGAGGGTGGGAAACTGG + Intronic
927080345 2:19622170-19622192 CAGGAGAAAGGGTGGGAAGCAGG + Intergenic
927101231 2:19789221-19789243 CATGAGCAAGGGTGGGAAGCAGG + Intergenic
927177651 2:20421899-20421921 AAGGAGGAAGGGAGGGAGACAGG - Intergenic
928697600 2:33865490-33865512 TGGGGGGAAGGGAGGGAAACAGG + Intergenic
929002787 2:37364557-37364579 GGTGAGGAATGGTGGGAAACAGG + Intronic
929370227 2:41214476-41214498 CAGGGGGAAGGGTGGGAGAGTGG - Intergenic
931552458 2:63461842-63461864 TTGGAGGACAGGTGGGAAACTGG - Intronic
932407290 2:71521990-71522012 GCGGAGGAAGGGAGGGAAGGTGG - Intronic
932471619 2:71962964-71962986 CCGGAGGAAGGGTGAGGAGGAGG + Intergenic
933127894 2:78634169-78634191 CGGGAGGAAGGGAGGGAAGAAGG + Intergenic
934519379 2:95010363-95010385 CCGGAGGCTGGGTGGGAAGGCGG + Intergenic
935798595 2:106670136-106670158 CAGGAGGAAGAGAGGGAAAAGGG - Intergenic
936173467 2:110197418-110197440 AAAGAGGAAGGGTGGGAAAGGGG - Intronic
936679814 2:114757212-114757234 CAGGAGGAAGGGTGGGGAAGAGG + Intronic
937002315 2:118479011-118479033 CCCTAGGAGGGGTGGGAATCAGG + Intergenic
937034541 2:118769852-118769874 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
937358124 2:121211240-121211262 CAGGAGGAAGGGAGGGAAGTTGG + Intergenic
938721571 2:134071715-134071737 GAGGAGGAAGGGTGAGAAATGGG - Intergenic
938861067 2:135370324-135370346 TCGGGGAAAGGGTGGGAAGCGGG - Intronic
939018998 2:136936665-136936687 CAGGAGAAAGGGTGGGAAGAGGG + Intronic
939881921 2:147640844-147640866 CTGGAGGAAGGGTGGGATGTAGG + Intergenic
941336044 2:164245084-164245106 AGGGAGGAAGGAAGGGAAACAGG - Intergenic
941369548 2:164647189-164647211 CAGTAGGAAGTGTGGCAAACTGG - Intergenic
942165152 2:173234202-173234224 TCGGAGGAAGGGTGGTGAGCTGG + Intronic
942325464 2:174772637-174772659 ATGAAGGAAGGGTGGGAAGCAGG - Intergenic
942601011 2:177641041-177641063 GCAGAGGAAGGCTGGGAGACTGG - Intronic
943071985 2:183152430-183152452 CGGGGGAAAGGGTGGGAAAGGGG - Intronic
943654783 2:190496905-190496927 CAGGGGAAAGGGTGGGAAAGGGG + Intronic
944177651 2:196850710-196850732 AGGGAGGAAGGGAGGGAAAGAGG + Intronic
944621112 2:201516983-201517005 CCGGAGGCAGGGAGGTACACGGG - Intronic
944737119 2:202577252-202577274 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
947932683 2:233976540-233976562 CGGGAGGAAGGGTGGGGGTCTGG + Intronic
948046745 2:234951620-234951642 CCGGAGAAGGGGTGGGAGATGGG + Intergenic
948198791 2:236114613-236114635 CCGGAGGAAAGGCAGGACACAGG - Intronic
948226972 2:236318898-236318920 CCTGAGGAATGGTGGGCACCAGG + Intergenic
948554287 2:238796552-238796574 CAGGAGGATGGGAGGGAACCAGG - Intergenic
1170803027 20:19606083-19606105 GGAGAGGAAGGCTGGGAAACTGG - Intronic
1171780987 20:29417602-29417624 ACTGAGGAAGGGTGAGAAAGGGG - Intergenic
1172205867 20:33162494-33162516 CAGGATTAAGGGTGGGAAAGAGG - Intronic
1172764988 20:37346369-37346391 CCGGAGGGGGGGTGGGAATTGGG - Intronic
1173966889 20:47119299-47119321 ACAGAGGAAGTGTGGGAAGCAGG - Intronic
1174178441 20:48659333-48659355 AAGGAGGAAGGGAGGGAAAGAGG + Intronic
1175160910 20:57006970-57006992 CAGGAGGTACGGTGAGAAACGGG - Intergenic
1175424874 20:58856912-58856934 CTGGGGGGAGGGTGGGGAACTGG - Intronic
1175820947 20:61908606-61908628 ACGGAGAAGGGGTGGGAAACGGG - Intronic
1175845042 20:62053739-62053761 CTGGGGGCAGGGTGGGATACGGG - Intronic
1176995303 21:15548528-15548550 ATGGAGGGAGGGTGGTAAACAGG + Intergenic
1177046960 21:16182934-16182956 TAGGAGGAAGGGAGGGAAAAAGG - Intergenic
1178083459 21:29089815-29089837 AGGGAGGAAGGGAGGGAAGCAGG + Intronic
1178297891 21:31426168-31426190 CAGGAGGAAGGGTGGGAGGTGGG - Intronic
1181164411 22:20975782-20975804 CAGGGTCAAGGGTGGGAAACAGG + Intronic
1183539834 22:38423568-38423590 CCGGATGCAGGGTGGGGAAGGGG - Intergenic
1183715832 22:39532896-39532918 GCGGAAGAAGGGGCGGAAACTGG + Intergenic
1183814717 22:40290080-40290102 GCCGAGGCAGGGTGGGGAACAGG - Intronic
1183901554 22:41009706-41009728 CAGGAGGAAGTGTGGGCAATGGG + Intergenic
1184737657 22:46408882-46408904 CCGGAGGAAGGGCGAGTAGCAGG + Intronic
949533391 3:4978494-4978516 CGGGAGGAAGGGGGTGACACTGG + Intergenic
951193523 3:19798468-19798490 AGGGAGGAAGGGAGGGAAAGAGG + Intergenic
951859657 3:27237645-27237667 CAGGAGGAAGGGTGGGAGTGGGG + Intronic
953038935 3:39237796-39237818 CCGGAGGGAGGGAGGGAAGCAGG - Intergenic
953068088 3:39493153-39493175 AAGGAGGAAGGGTGGGAAGAAGG + Intronic
953277303 3:41514786-41514808 TGGGAGGAAGGATGAGAAACTGG + Intronic
953284422 3:41592409-41592431 AGGGAGAAAGGGTGGGAAAGGGG + Intronic
953517708 3:43612421-43612443 CCTGAGAAAGGCAGGGAAACTGG - Intronic
954934507 3:54314043-54314065 AGGGAGTAAGGGTGGGAAGCAGG - Intronic
957084008 3:75663683-75663705 ACTGAGGAAGGGTGAGAAAGGGG + Intergenic
957550176 3:81694239-81694261 GAGGAGGAAGGGAGGGAAAAAGG + Intronic
958486114 3:94711734-94711756 GTTGAGGAAGGGTGTGAAACGGG - Intergenic
959558632 3:107753255-107753277 GGGAAGGAAGGGTGGAAAACTGG - Intronic
960508967 3:118525604-118525626 CAGCAGGAAGGATGGGGAACTGG + Intergenic
960750636 3:120948550-120948572 CAGGAGGAAGGGTGGGAGTTGGG - Intronic
962502878 3:136012942-136012964 TGGGAGGAAGGGTGGGAAGGGGG - Intronic
962789991 3:138802444-138802466 GCGGAGGAAAGGAGGGAAAGAGG + Intronic
962799237 3:138875889-138875911 CAGGAGGAAAAGTGGGAGACAGG - Intergenic
962810134 3:138952374-138952396 CCAGAGGAAGGGAGGGAGAAGGG + Exonic
962853299 3:139323853-139323875 CCTGAGGAGGGGTGGGAAGCAGG - Intronic
963063147 3:141241305-141241327 AGGGAGGGAGGGTGGGAAAAAGG - Intronic
963473701 3:145776572-145776594 AGGGAGGAAGGGAGAGAAACAGG - Intergenic
963688120 3:148463567-148463589 CAGGAGAAAGGGTGGGAGGCGGG + Intergenic
964903872 3:161694045-161694067 AGGGAGGAAGGGAGGGAAAGAGG - Intergenic
966288531 3:178326686-178326708 CTGAAGGAAGGGTGGGAAATAGG - Intergenic
967459081 3:189724472-189724494 CCGGGGAAAGGGTGGGAAGAGGG - Intronic
967971095 3:195000050-195000072 CCAGAGGAAGGGCGGGGGACAGG - Intergenic
968441712 4:627724-627746 CAGGAGGAAGGAAGGGAGACGGG - Intronic
969658012 4:8509195-8509217 ACGGAGGGAGGGAGGGAAAAGGG + Intergenic
969699358 4:8758405-8758427 TCGGGGAAAGGGTGGGAAGCGGG + Intergenic
971393678 4:26209554-26209576 AAGGAGGAAGGGAGGGAGACAGG - Intronic
971393686 4:26209578-26209600 AAGGAGGAAGGGAGGGAGACAGG - Intronic
972312647 4:37895342-37895364 CAGGAAAAAGGGTGGGAAATGGG - Intronic
975032161 4:69634379-69634401 CCAGGGAAAGGGTGGGAAGCAGG + Intronic
977507351 4:97918809-97918831 TCGGGGGAAGGGTGGGAGACAGG + Intronic
977853945 4:101865045-101865067 CAGGAAGAAGGGTTGGAGACAGG + Intronic
980400918 4:132284730-132284752 CAGGAGGAAGCGTGTGAAATGGG - Intergenic
981674237 4:147322821-147322843 CAGGAGGGAGGGAGGGAAAGAGG + Intergenic
981756655 4:148147202-148147224 ATGGAGGAAAGGTGGGAAATAGG - Intronic
982075783 4:151735865-151735887 TCGGAGGAAGAGTGGGAAGGGGG + Intronic
983285805 4:165737546-165737568 CCAGAGGAAGTGGTGGAAACAGG - Intergenic
985660870 5:1155942-1155964 CGGGAGGAAGGGAGGGAGGCCGG + Intergenic
985929531 5:3046382-3046404 CCGGAGGAAGGGTGTGGACATGG - Intergenic
985930742 5:3055744-3055766 CCGGATGCTGGGTGGGAAAAGGG - Intergenic
986259895 5:6134914-6134936 CCTGAGGAAGAGTGGGAGAAAGG + Intergenic
986636016 5:9823458-9823480 AGGGAGGAAGGGAGGGAAAAGGG + Intergenic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987739471 5:21887516-21887538 CCAGAGGAAGAATGGGACACTGG - Intronic
988703948 5:33705052-33705074 TCGGAGGAAGGCTGGTAGACAGG - Intronic
990413920 5:55567894-55567916 TAGGGGGAAGGGTGGGAAAGGGG - Intergenic
991922628 5:71671896-71671918 CGGGGGGAGGGGTGGGACACAGG - Intergenic
992080646 5:73232673-73232695 CTGGAGGAAGAGTGGGGAAGCGG - Intergenic
992804098 5:80320021-80320043 GGGGAGGAAGGGTGGGAAAGGGG - Exonic
992878779 5:81084481-81084503 ATCGTGGAAGGGTGGGAAACAGG - Intronic
994080730 5:95706385-95706407 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
994081613 5:95713458-95713480 CAGGAGGAAGGGAGGGAAGGGGG - Intergenic
995968960 5:117943687-117943709 CCAGAGGAAGCGTGGGAACGGGG - Intergenic
997424994 5:133797004-133797026 CAAGAGGAAGGGTGGTAAAGGGG - Intergenic
997710282 5:135998374-135998396 CCAGAGGAAGGGAGGCAAACAGG + Intergenic
997710536 5:136000571-136000593 CCAGAGGAAGGGAGGCAAACAGG - Intergenic
998170267 5:139868636-139868658 CGGGAGGTGGGGTGGGAAAAGGG - Intronic
998175640 5:139900434-139900456 CTGGAGGAAGACTGGGAAAATGG + Intronic
998479735 5:142452842-142452864 ATGGAGGAATGGTGAGAAACTGG - Intergenic
999114218 5:149148416-149148438 TCAGAGGAAAGGAGGGAAACTGG + Intronic
1000339536 5:160266529-160266551 CAGGAGTGAGGATGGGAAACTGG - Intronic
1001108476 5:168875717-168875739 AGAGAGGAAGGGAGGGAAACAGG + Intronic
1001644162 5:173268070-173268092 CCAGAGGAAGGGTGGAGAGCTGG - Intergenic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002825005 6:764590-764612 CAGAAGGAAGGGTGGGGACCTGG - Intergenic
1003872214 6:10412452-10412474 GAGGAGGAAGGGAGGGAAAGAGG + Intronic
1004285985 6:14321404-14321426 CAGGAGGAAAGGGGGGAAATTGG - Intergenic
1005893499 6:30159108-30159130 CCTGAGGAAGGGGAGGAACCTGG + Intronic
1006029601 6:31169815-31169837 CAGGACTAAGGGTGGGAAAAGGG + Intronic
1006924482 6:37647076-37647098 CCAGAGGAAGGGTCGGAGATGGG - Intronic
1007071477 6:39041411-39041433 CTGGAGGAAAGGTGGGGAGCTGG - Intergenic
1007502028 6:42305618-42305640 CCAGGGGAAGGGAGGGACACAGG + Intronic
1008631235 6:53364365-53364387 GCTGAGGAATAGTGGGAAACAGG + Intergenic
1010766859 6:79784947-79784969 CCAAAGGAAGGGGGGGAAATAGG + Intergenic
1012616047 6:101281471-101281493 CTGGAGGGAGGCTGGAAAACAGG - Intergenic
1012796546 6:103769563-103769585 CCAGAGGAAGGAAGGGAAGCTGG - Intergenic
1013370523 6:109466778-109466800 CCTGAGGAAGGGTGGCAGATGGG + Intronic
1013933742 6:115568536-115568558 CCGGGGGGAGGGTGGGAGAGGGG + Intergenic
1015099706 6:129462111-129462133 AGGGAGGAAGAGTGGGAAGCCGG + Intronic
1015184518 6:130399355-130399377 CAGTAGAAAGGATGGGAAACAGG - Intronic
1016546463 6:145229585-145229607 AGGGAGGGAGGGAGGGAAACAGG - Intergenic
1017879143 6:158547745-158547767 CCGGGGGCAGGGTGGGAGACGGG - Intronic
1018081273 6:160261330-160261352 CCGTAGAAAGGGTGGTACACTGG - Intronic
1018243729 6:161802518-161802540 CCGGAGAAAGGCTGGGAGCCAGG - Intronic
1019704137 7:2489453-2489475 CTGGAGGAGGGGTGGGAGAAAGG + Intergenic
1021888552 7:25164773-25164795 CAGGGGGAAGGTTGGGAAAGGGG - Intronic
1022554279 7:31276222-31276244 AGGGAGGAAGAGTGGGAAAGGGG + Intergenic
1022596493 7:31718275-31718297 CGGGAGGAAGGCTTGGAAAATGG + Intergenic
1023259061 7:38340496-38340518 CCTGGGGGAGGGTGGGGAACAGG + Intergenic
1023260467 7:38353509-38353531 CCTGGGGGAGGGTGGGGAACAGG + Intergenic
1023261441 7:38362658-38362680 CCTGGGGGAGGGTGGGGAACAGG + Intergenic
1023261944 7:38367395-38367417 CCTGGGGGAGGGTGGGGAACAGG + Intergenic
1023366402 7:39468296-39468318 CAGGAGGGAGGGCAGGAAACAGG + Intronic
1023888227 7:44375629-44375651 CCGAAGGAAGGGTGGGGGCCTGG + Intergenic
1025776383 7:64564316-64564338 CTGGAAGAAAGGTGGGCAACAGG - Intergenic
1025864935 7:65372638-65372660 CTGGAAGAAAGGTGGGCAACAGG + Intergenic
1026632398 7:72048769-72048791 AAGGAGGAAGGGAGGGAAAAAGG - Intronic
1026955016 7:74371604-74371626 AAGGAGGGAGGGAGGGAAACAGG + Intronic
1028104775 7:86864170-86864192 CGGGGGGAAGGGTGGGAAGGAGG - Intronic
1029053657 7:97717046-97717068 GCGGGGGAAGGGTGGGAAGGGGG + Intergenic
1029654336 7:101914411-101914433 ACGGAGGGAGGGAGGGAAAGAGG - Intronic
1031256990 7:119465557-119465579 CTGGTGGAAGGGTGTGAAAAAGG - Intergenic
1031798948 7:126217439-126217461 CTGGGGGAAGGGTGGGAAGGGGG - Intergenic
1032083552 7:128872188-128872210 CCAGCTGAAGGGTGGCAAACAGG + Intronic
1032650434 7:133872115-133872137 CTGGAGGAAAGGTGGGGATCAGG + Intronic
1033578068 7:142705013-142705035 CCTGAGGCAGGGTGGGGAAGGGG - Intergenic
1033578213 7:142707049-142707071 CCTGAGGCAGGGTGGGGAAGAGG - Intergenic
1033622854 7:143077715-143077737 CTCGAGGAAGGGTGTGAATCTGG + Intergenic
1033981055 7:147166386-147166408 CCGGAGGAAGGATGGGAGGCGGG + Intronic
1035777076 8:2196359-2196381 CCCGAGGAAGGCTTGGATACAGG - Intergenic
1036767300 8:11556999-11557021 ACAGAGGGAGGGTGAGAAACAGG + Intronic
1038030126 8:23631068-23631090 GCGGAGAAAGGGTGGGAAGCAGG - Intergenic
1038642727 8:29340636-29340658 CCTGAGGAAGGGCTGGAATCAGG - Intronic
1039000738 8:32977230-32977252 CGGGAGAAAGGGTGGGAAGGAGG - Intergenic
1040713536 8:50219610-50219632 CAGGAGGAAGAGAGAGAAACGGG + Intronic
1041143113 8:54843734-54843756 CTGGAGCAAGGGTGGGAACAAGG - Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042099771 8:65262432-65262454 CGGGGGGAAGGGTGGAAAGCAGG - Intergenic
1044891752 8:96843330-96843352 AAGGAGGAAGGGAGGGAAGCAGG + Intronic
1045529880 8:102974384-102974406 CGGGAGGAAGGGTGGGAAGGAGG - Intronic
1047008235 8:120643417-120643439 CAGGAGGAAGGGTGGGAGGGTGG - Intronic
1047289965 8:123521200-123521222 CTGGGGGTAGAGTGGGAAACAGG - Intronic
1048492556 8:134907509-134907531 CAAGAGGAAGGGTGGGAAGAGGG - Intergenic
1048979908 8:139697703-139697725 TCTGAGGAGGGGTGGGAATCAGG - Intronic
1048999009 8:139813016-139813038 CCTGAGGAAGGGTGGAGAAGTGG - Intronic
1049118180 8:140708465-140708487 CCGAAGGTAGGGTGTGAAAAAGG - Intronic
1052891549 9:33704825-33704847 CCTGAGGCAGGGTGGGGAAGGGG - Intergenic
1054835601 9:69672381-69672403 CGGGAGGGAGGGTGGGGAAAGGG - Intergenic
1057194793 9:93110939-93110961 ACGGAGGAAGGGGGAGAAAGTGG - Intronic
1057483294 9:95462601-95462623 CCTGAGGAAGGGTGGCAGAGAGG - Intronic
1057489762 9:95511448-95511470 CCCGAGGAAGAGAGGGAGACGGG + Intronic
1058852585 9:109027186-109027208 CCGGAAGTAGGGTGGGAGATGGG + Intronic
1059255372 9:112925573-112925595 CCCCAGGAAGGGAGGGAAAATGG + Intergenic
1059459053 9:114418208-114418230 CCTGAGGAAGGGTGAGCAAAAGG + Intronic
1059459058 9:114418239-114418261 CCTGAGGAAGGGTGAGCAAAAGG + Intronic
1059521476 9:114946791-114946813 GGCGAGGAAGGGTGGGAAAAGGG - Intergenic
1059774346 9:117460704-117460726 GAGGAGGAGGGGTGGGAAAGAGG + Intergenic
1061695515 9:132370340-132370362 CTGGAGGAAAGGATGGAAACAGG + Intergenic
1061803566 9:133126211-133126233 CCGGGGGGAGGTTGGGAACCTGG - Intronic
1062170651 9:135133028-135133050 CAGTTTGAAGGGTGGGAAACCGG + Intergenic
1062452621 9:136621888-136621910 CCGCAGGTGGGGTGGGTAACGGG + Intergenic
1185734285 X:2485581-2485603 AAGGAGGAAGGGAGGGAGACAGG + Intronic
1186621815 X:11249267-11249289 AGGGAGAAAGGGTGGGAAAGGGG + Intronic
1186827471 X:13354762-13354784 CAAGAGGAAGGGTAGGAACCAGG - Intergenic
1188865634 X:35310134-35310156 AAGGAGGAAGTGAGGGAAACGGG + Intergenic
1189174781 X:38945097-38945119 CGGGAGAAAGGGTGGGAAAGGGG - Intergenic
1189744210 X:44153586-44153608 CCAAAGGAAGGTTAGGAAACAGG + Intronic
1193423297 X:81310271-81310293 AGGGAGAAAGGGTGGGAAGCAGG - Intergenic
1194239581 X:91427824-91427846 CCGGGGAAAGGGTGGGAGGCGGG + Intergenic
1194347369 X:92782817-92782839 CAGGGGGAAGGGTGGGAAAGAGG + Intergenic
1195637990 X:107139820-107139842 ACGGAGGAAGGGAAGGATACAGG + Intronic
1195681451 X:107549969-107549991 CCAGAGGAAGGGTGTGAAAAAGG - Intronic
1195720531 X:107863459-107863481 CTAGAGGAGGGATGGGAAACGGG - Intronic
1198616992 X:138469188-138469210 TCGGAGGAAGGGTGGGAAGGGGG + Intergenic
1200072360 X:153535524-153535546 CCGGAGGAAGGGTGGGAAACAGG - Intronic
1200655692 Y:5899450-5899472 CAGGGGGAAGGGTTGGAAAGAGG + Intergenic
1201765414 Y:17569849-17569871 ACGGAGGAAGGGAGGGAGAGAGG + Intergenic
1201836138 Y:18336140-18336162 ACGGAGGAAGGGAGGGAGAGAGG - Intergenic
1201942564 Y:19475552-19475574 CCAGAGGAAGGCTGAGAACCTGG + Intergenic