ID: 1200072398

View in Genome Browser
Species Human (GRCh38)
Location X:153535650-153535672
Sequence TAAGATGCGCCCTGTGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 83}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200072398_1200072407 25 Left 1200072398 X:153535650-153535672 CCCGCTGCACAGGGCGCATCTTA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1200072407 X:153535698-153535720 GGAGTGAACAAGCGCAGGACTGG 0: 1
1: 0
2: 0
3: 13
4: 112
1200072398_1200072404 4 Left 1200072398 X:153535650-153535672 CCCGCTGCACAGGGCGCATCTTA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1200072404 X:153535677-153535699 GGCAAGAGCAGGGAGTGAACCGG 0: 1
1: 0
2: 1
3: 68
4: 955
1200072398_1200072401 -7 Left 1200072398 X:153535650-153535672 CCCGCTGCACAGGGCGCATCTTA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1200072401 X:153535666-153535688 CATCTTAACCAGGCAAGAGCAGG 0: 1
1: 0
2: 0
3: 19
4: 169
1200072398_1200072408 28 Left 1200072398 X:153535650-153535672 CCCGCTGCACAGGGCGCATCTTA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1200072408 X:153535701-153535723 GTGAACAAGCGCAGGACTGGTGG 0: 1
1: 0
2: 2
3: 7
4: 149
1200072398_1200072402 -6 Left 1200072398 X:153535650-153535672 CCCGCTGCACAGGGCGCATCTTA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1200072402 X:153535667-153535689 ATCTTAACCAGGCAAGAGCAGGG 0: 1
1: 0
2: 0
3: 12
4: 150
1200072398_1200072405 20 Left 1200072398 X:153535650-153535672 CCCGCTGCACAGGGCGCATCTTA 0: 1
1: 0
2: 0
3: 8
4: 83
Right 1200072405 X:153535693-153535715 GAACCGGAGTGAACAAGCGCAGG 0: 1
1: 0
2: 10
3: 26
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200072398 Original CRISPR TAAGATGCGCCCTGTGCAGC GGG (reversed) Intronic
901841966 1:11959323-11959345 CTAGATGCGTCCTGTGCACCAGG - Intronic
902178672 1:14670794-14670816 TCAGGTGACCCCTGTGCAGCTGG + Intronic
902615579 1:17621804-17621826 TCACTTGGGCCCTGTGCAGCAGG + Intronic
902987821 1:20166159-20166181 AAAGCAGCGCCCTGTGGAGCCGG + Intronic
909863682 1:80638387-80638409 GAAGATTCCACCTGTGCAGCAGG + Intergenic
915321271 1:155057682-155057704 TCAGATGCACACTGTGCACCTGG - Exonic
916042499 1:160973327-160973349 CAAGATGGGCTCTGTGCAGCCGG + Intergenic
922062367 1:222104704-222104726 CAAGTGGCTCCCTGTGCAGCAGG + Intergenic
1069901854 10:71710962-71710984 TATGATGAGACCTGTGCCGCCGG + Intronic
1074065330 10:110008114-110008136 TACGCCGAGCCCTGTGCAGCAGG - Exonic
1074194160 10:111165980-111166002 TAAAATGAGCCCTGTGGTGCTGG - Intergenic
1079679161 11:23271924-23271946 TAAGATCAGCCCTTTGCAACTGG + Intergenic
1081577817 11:44330163-44330185 TAAGTATCCCCCTGTGCAGCGGG + Intergenic
1081834568 11:46143281-46143303 TGACCTGCGCCCGGTGCAGCGGG + Intergenic
1084285360 11:68127817-68127839 GGAGAGGGGCCCTGTGCAGCCGG - Intergenic
1084839735 11:71836052-71836074 TAAAATTGGCCCTTTGCAGCTGG - Intronic
1090012198 11:123055209-123055231 CCAGTAGCGCCCTGTGCAGCAGG + Intergenic
1090349787 11:126100673-126100695 TTATAGGAGCCCTGTGCAGCAGG - Intergenic
1091755643 12:3049679-3049701 AAAGATACACCCTGTGGAGCAGG - Intergenic
1091822907 12:3490147-3490169 TAAGATGCTCCCTGAGCACCCGG - Intronic
1092312967 12:7378232-7378254 TAGGATGCTCACTGTGGAGCTGG - Intronic
1097788882 12:63792712-63792734 TCAGAACCACCCTGTGCAGCTGG + Intronic
1100382457 12:94074348-94074370 TTAGGAGCGCCCTGAGCAGCGGG - Intergenic
1105502013 13:20981057-20981079 TGAGTTGTGCCGTGTGCAGCTGG - Intronic
1121311201 14:92936103-92936125 TAAGAAGCTCACTGTCCAGCGGG + Intergenic
1122010899 14:98746088-98746110 TTAGATGCTTTCTGTGCAGCAGG + Intergenic
1127750157 15:62030017-62030039 TAAGATGACACCTGTGCAGCTGG + Intronic
1129057955 15:72835598-72835620 TAAGATCAGCCCTGTAGAGCAGG + Intergenic
1130117003 15:81014157-81014179 TAGGATGCTGGCTGTGCAGCTGG - Intronic
1136265957 16:29118553-29118575 CAAGCTCCGCCCTGTGCAGATGG - Intergenic
1141249164 16:82339178-82339200 TAGGAGGGGCTCTGTGCAGCTGG - Intergenic
1141982694 16:87560280-87560302 GTAGAGGCGCCCTGGGCAGCAGG + Intergenic
1142054769 16:87986459-87986481 CAAGCTCCGCCCTGTGCAGATGG - Intronic
1143335883 17:6171170-6171192 TAAGAGGTGCCCAGGGCAGCTGG - Intergenic
1148037296 17:44676523-44676545 TAAAATTTGCCCTTTGCAGCTGG + Intronic
1150418081 17:65003592-65003614 TAAGATGCTTCCAGTCCAGCAGG - Intergenic
1150502493 17:65664642-65664664 TAAGATGTGACCGATGCAGCAGG + Intronic
1150793598 17:68220623-68220645 TAAGATGCTTCCAGTCCAGCAGG + Intergenic
1152242810 17:79169093-79169115 ACGGATCCGCCCTGTGCAGCTGG - Intronic
1155244529 18:23894718-23894740 TAAAATGCTCCCTGTGCACAGGG + Intronic
1156854689 18:41768123-41768145 TAAGAGGTGCTCTGTCCAGCGGG + Intergenic
1159198332 18:65148264-65148286 CAAGATGTGGCCAGTGCAGCTGG - Intergenic
1163136918 19:15318590-15318612 TAATGTGTGCCCTGTGCTGCGGG - Intronic
933380705 2:81539806-81539828 CAGGATGCCACCTGTGCAGCTGG - Intergenic
937506112 2:122538602-122538624 TAAGATGGGCCCTTTACAGGGGG + Intergenic
940106748 2:150109801-150109823 TAAGATGCTCCCTGTCTAGCAGG + Intergenic
942923416 2:181404673-181404695 TCACATGGGACCTGTGCAGCAGG - Intergenic
945510615 2:210697883-210697905 GAAGATGCTCCATGTTCAGCTGG + Intergenic
946084685 2:217158631-217158653 TATGATGCTACCTGAGCAGCTGG + Intergenic
1174254762 20:49246329-49246351 TAAGATGGGCCTTATGCAGCAGG - Exonic
1175264082 20:57692178-57692200 TACGATGCCCCCTGTGTAGTGGG + Intronic
1175358520 20:58389136-58389158 GAAGCTGCGCCCTGCGCCGCCGG - Exonic
953918438 3:46935574-46935596 TAAGATGTGCCCTGGAAAGCTGG - Intronic
955106929 3:55907377-55907399 TCACAAGAGCCCTGTGCAGCAGG - Intronic
962173263 3:133125347-133125369 TAACAAGCACCCTGTGCATCTGG + Intronic
967868031 3:194206315-194206337 TGAAATGGGCCCTGGGCAGCTGG + Intergenic
969780821 4:9402060-9402082 TAAAATTGGCCCTTTGCAGCTGG - Intergenic
976002219 4:80386692-80386714 ACAAATGCGCCCTGTGCAGCAGG - Intronic
981672641 4:147304692-147304714 CAAGATGAGCCCTCTACAGCAGG - Intergenic
983216853 4:165010126-165010148 TAAGGTGGGCCCTCTTCAGCAGG + Intergenic
985701314 5:1374800-1374822 TTAGTTGCTCCCTGTGGAGCCGG + Intergenic
986007290 5:3678440-3678462 AAAGAAGGGCCTTGTGCAGCCGG + Intergenic
986092342 5:4522833-4522855 TGAGATTCTCCCTGTGAAGCTGG + Intergenic
992649406 5:78843023-78843045 TGAGATGCAGCCTGTGCATCTGG - Intronic
996339695 5:122422950-122422972 TAAGTTCCGCCCAGTGAAGCGGG + Exonic
997619516 5:135276478-135276500 GAAGAAGCCGCCTGTGCAGCTGG + Intronic
998553769 5:143102989-143103011 TCAGATCCCCCCTGTGAAGCTGG - Intronic
1000663434 5:163964734-163964756 AAACCTGAGCCCTGTGCAGCTGG - Intergenic
1000874435 5:166618680-166618702 TAAAATGAGTCCTATGCAGCTGG - Intergenic
1002547367 5:179958522-179958544 TGAGATGCGTCCTGTGCTGAGGG - Intronic
1005438860 6:25843468-25843490 CAAGATGAGCCCTTTTCAGCGGG - Intronic
1007279725 6:40702392-40702414 TAAGATGTGTCCTTTGCTGCAGG - Intergenic
1013109199 6:107051598-107051620 TAAAATGTTCCCTGTCCAGCGGG + Intergenic
1022596478 7:31718206-31718228 AAAGATGCAGCCTGTGGAGCTGG - Intergenic
1024253219 7:47521713-47521735 AAAAATGAGCCCTGTGCAGCCGG + Intronic
1028402855 7:90443088-90443110 AAAGAAGTGGCCTGTGCAGCTGG - Intronic
1032856890 7:135842324-135842346 TAATATGTGCCCCCTGCAGCTGG - Intergenic
1036278254 8:7375993-7376015 TAAAATTGGCCCTTTGCAGCTGG - Intronic
1036343268 8:7935897-7935919 TAAAATTGGCCCTTTGCAGCTGG + Intronic
1036838602 8:12096660-12096682 TAAAATTGGCCCTTTGCAGCTGG + Intergenic
1036860391 8:12342904-12342926 TAAAATTGGCCCTTTGCAGCTGG + Intergenic
1038582980 8:28766113-28766135 TAAGTTGCACCCTGTTCATCGGG + Intergenic
1040478756 8:47804594-47804616 TAAGATGTGGCATGTCCAGCCGG - Intronic
1044365935 8:91345658-91345680 CAAGATGCCCACTGTGCGGCAGG + Intronic
1053270228 9:36744625-36744647 TAGGAAGCGCCCTGTGTTGCTGG - Intergenic
1058608269 9:106746942-106746964 TAAGAAGCGCAGTGTGCATCGGG + Intergenic
1060876748 9:127089412-127089434 TCAGAGCCGCCCTGTGCGGCAGG - Intronic
1062157652 9:135062317-135062339 TAAGCTGAGCTCTTTGCAGCAGG - Intergenic
1186403478 X:9280990-9281012 TAAGATGAGGCCTGTGCATCTGG - Intergenic
1187498347 X:19815223-19815245 TAAGATGCAGCCTGGGCATCGGG + Intronic
1198465664 X:136902582-136902604 TAAGATGTGGCCTCTGGAGCTGG + Intergenic
1200072398 X:153535650-153535672 TAAGATGCGCCCTGTGCAGCGGG - Intronic