ID: 1200078258

View in Genome Browser
Species Human (GRCh38)
Location X:153562566-153562588
Sequence GCACCCTGATCAATAATCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 76}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200078257_1200078258 2 Left 1200078257 X:153562541-153562563 CCACATATTTTAAATCAATCAAA 0: 1
1: 0
2: 3
3: 68
4: 761
Right 1200078258 X:153562566-153562588 GCACCCTGATCAATAATCCATGG 0: 1
1: 0
2: 0
3: 5
4: 76
1200078254_1200078258 30 Left 1200078254 X:153562513-153562535 CCAATTGGGTGGGTAGCTTGGGA 0: 1
1: 1
2: 0
3: 7
4: 76
Right 1200078258 X:153562566-153562588 GCACCCTGATCAATAATCCATGG 0: 1
1: 0
2: 0
3: 5
4: 76
1200078256_1200078258 3 Left 1200078256 X:153562540-153562562 CCCACATATTTTAAATCAATCAA 0: 1
1: 0
2: 3
3: 63
4: 549
Right 1200078258 X:153562566-153562588 GCACCCTGATCAATAATCCATGG 0: 1
1: 0
2: 0
3: 5
4: 76
1200078255_1200078258 4 Left 1200078255 X:153562539-153562561 CCCCACATATTTTAAATCAATCA 0: 1
1: 0
2: 2
3: 53
4: 494
Right 1200078258 X:153562566-153562588 GCACCCTGATCAATAATCCATGG 0: 1
1: 0
2: 0
3: 5
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200078258 Original CRISPR GCACCCTGATCAATAATCCA TGG Intronic
907553951 1:55328569-55328591 GCACACAGATCATTAATGCAGGG - Intergenic
908055913 1:60287082-60287104 GCACCCTGAGCAATCCTTCATGG + Intergenic
909596561 1:77412868-77412890 CCACACTGATCATCAATCCACGG + Intronic
916394414 1:164369962-164369984 GCACCTTTTTAAATAATCCATGG - Intergenic
920524454 1:206656391-206656413 AAACCCTGTTCAAGAATCCAGGG - Intronic
923888364 1:238182756-238182778 GCACACTTCTAAATAATCCATGG - Intergenic
1064307709 10:14182901-14182923 GCAGCCTAATCAACAATCCCAGG - Intronic
1065486702 10:26242737-26242759 GTACCGTGATCAATTATCCTGGG + Intronic
1068162826 10:53288360-53288382 ACAACTTGATAAATAATCCAGGG + Intergenic
1071472935 10:85998369-85998391 GCACACTTATAAATAATCCATGG + Intronic
1077116019 11:884978-885000 ACACCCAGATCTATAAGCCAAGG + Intronic
1084799213 11:71530884-71530906 ACCCCCTGACCAATAAACCAAGG - Intronic
1093389133 12:18596809-18596831 GAGCCCAGATCAATTATCCATGG + Intronic
1093671377 12:21880037-21880059 GGACAGTGATCAATAATACATGG + Intronic
1099821452 12:87716471-87716493 ACACCATGATCAATTAGCCAAGG + Intergenic
1104548125 12:129731058-129731080 GAACCCTGATTAATACACCAGGG + Intronic
1104793106 12:131496362-131496384 CCACCTTGATGAATTATCCACGG - Intergenic
1109519375 13:63487589-63487611 GAACCCTGACTAATAATACATGG + Intergenic
1110350276 13:74499252-74499274 GCACATTTATCAATAATCCATGG - Intergenic
1113055631 13:106263968-106263990 GCACCCTGTGGAACAATCCAAGG + Intergenic
1114652583 14:24295530-24295552 GGGCCCTGATGAATTATCCAAGG - Intronic
1117256608 14:53984663-53984685 GCATGCTCCTCAATAATCCATGG - Intergenic
1117518383 14:56525489-56525511 ACACCCTCATCCATAATCCTGGG - Intronic
1118298512 14:64592717-64592739 GCACCCTTATCAAAAATCAATGG - Intergenic
1124342946 15:28901697-28901719 GCTCCCACATCAATCATCCAGGG - Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1127323479 15:57870224-57870246 ACACACTGCTAAATAATCCATGG + Intergenic
1131377924 15:91940703-91940725 GAACCCTGATCAATACTCACAGG - Intronic
1134229086 16:12415336-12415358 GCATCTTGATCAAGACTCCAAGG - Intronic
1139307579 16:66000531-66000553 GCACACTGAAAAATCATCCAAGG - Intergenic
1147244390 17:39110629-39110651 GCAGCCTGATTAATGACCCAGGG - Intronic
1150664311 17:67117358-67117380 GCACCTTTCTAAATAATCCATGG + Intronic
1156378758 18:36538080-36538102 ACACCCTTCTAAATAATCCATGG + Intronic
1157964187 18:52189733-52189755 GCACCCTGATCAGAGAACCATGG + Intergenic
1166736917 19:45091296-45091318 GCACCCTGATCGCGAATCCTCGG - Exonic
925089489 2:1142239-1142261 GCTCCATGATCAATTAGCCATGG + Intronic
925947816 2:8881973-8881995 GCACTCTGATGACTAATCTAAGG - Intronic
928698592 2:33875925-33875947 GCACCCTTGTCAAAAATCAACGG + Intergenic
938559208 2:132456135-132456157 GCACCCAGATCCATAAAGCAAGG - Intronic
939682642 2:145157672-145157694 CTAGCCTGATCCATAATCCAAGG + Intergenic
943064942 2:183075886-183075908 GCTCCCTCATCAATCAGCCATGG + Intergenic
1169013540 20:2272350-2272372 TCATCCTTATAAATAATCCATGG + Intergenic
1171965500 20:31527007-31527029 GGACCCTGATCAAGAGACCAAGG - Intronic
1172609034 20:36235758-36235780 GAACCCTGATTAATAGTGCAGGG + Intergenic
1178380430 21:32103094-32103116 GCACCCTTCTAAATAATCCATGG - Intergenic
953252060 3:41254374-41254396 GCACACTCCTAAATAATCCAAGG + Intronic
956033885 3:65069356-65069378 GCAGCTAGATCAATACTCCAGGG - Intergenic
972684266 4:41336388-41336410 CCACCCTCATCATTCATCCATGG + Intergenic
980114723 4:128668224-128668246 GCACCCTGCTCTCTAATTCAAGG - Intergenic
987156549 5:15095343-15095365 GCACGCAGATCATGAATCCAGGG - Intergenic
987394694 5:17411988-17412010 ACACCGTGTTCAATAATCCGTGG - Intergenic
987581882 5:19804723-19804745 TCGCCCTCATTAATAATCCAGGG - Intronic
987816162 5:22902867-22902889 GCACCTTTATCAAAAATCGATGG + Intergenic
994084477 5:95743434-95743456 GCTCCCTGCTCAACAATGCAGGG - Intronic
1000423263 5:161061383-161061405 GAGCCCTAATCAATAACCCATGG - Intergenic
1003400386 6:5785839-5785861 AGACCCTGGTCAATAATTCATGG + Intergenic
1006042997 6:31270837-31270859 GACCCCTGATCAGTATTCCAGGG + Intronic
1007885123 6:45218991-45219013 GCACACTTCTAAATAATCCATGG + Intronic
1008292386 6:49732994-49733016 GCTCCCTGTTCAATAATACTTGG + Intronic
1008408062 6:51141309-51141331 GCACACTGATTAGTCATCCATGG - Intergenic
1008857489 6:56107803-56107825 GCACCTTTACCAATATTCCACGG - Intronic
1011505532 6:88038299-88038321 ACATTCTGATAAATAATCCATGG + Intergenic
1013107998 6:107042392-107042414 GCACCCTGATCAGAATGCCAAGG - Intronic
1015413275 6:132918999-132919021 TCAAACTGATTAATAATCCAAGG - Intergenic
1016365342 6:143310377-143310399 GCACACTAATAAATAACCCATGG + Intronic
1018099765 6:160427121-160427143 GCACCCTGAGCAAGAAGCAATGG + Intronic
1019884966 7:3895839-3895861 ACACACTTATAAATAATCCATGG - Intronic
1024124594 7:46279787-46279809 GTACACTGCTAAATAATCCATGG - Intergenic
1024227896 7:47341968-47341990 GCACACTTATAAATAATCTATGG - Intronic
1028657772 7:93230541-93230563 GCACTTTGATTAATAATCTATGG - Intergenic
1028858112 7:95615015-95615037 GCACCCAGATTAATAAAGCAAGG + Intergenic
1037955736 8:23056761-23056783 ACACACTTATAAATAATCCATGG - Intronic
1040288894 8:46114307-46114329 GCACCCTGCTCCATAACCTAGGG + Intergenic
1041681936 8:60602724-60602746 TCAACCTGATCAAGAATCAATGG - Intronic
1045170230 8:99657897-99657919 ACACCCTTATCAACCATCCATGG + Intronic
1047597272 8:126391558-126391580 GCATCCTGGCCTATAATCCATGG - Intergenic
1062467226 9:136686749-136686771 GCGCCCTGATCAATAGCCCTGGG + Intronic
1193080916 X:77405108-77405130 GCACCCTAATCTTTAAACCAGGG - Intergenic
1196103223 X:111869294-111869316 TCACTCAGATCACTAATCCATGG + Intronic
1197936833 X:131748053-131748075 GCTCCCTGATCAGACATCCAGGG + Intergenic
1199658915 X:150026994-150027016 GCACACTTCTCAATAATCCATGG + Intergenic
1200078258 X:153562566-153562588 GCACCCTGATCAATAATCCATGG + Intronic