ID: 1200081172

View in Genome Browser
Species Human (GRCh38)
Location X:153577189-153577211
Sequence CTACTCCAGCGTGCCCCTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 157}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200081172_1200081175 -7 Left 1200081172 X:153577189-153577211 CCGGGAGGGGCACGCTGGAGTAG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1200081175 X:153577205-153577227 GGAGTAGCCGGTGAGACCGGAGG 0: 1
1: 0
2: 0
3: 8
4: 106
1200081172_1200081180 28 Left 1200081172 X:153577189-153577211 CCGGGAGGGGCACGCTGGAGTAG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1200081180 X:153577240-153577262 AGAAGCCCAGCCTGGAAGGAAGG 0: 1
1: 0
2: 1
3: 39
4: 391
1200081172_1200081179 24 Left 1200081172 X:153577189-153577211 CCGGGAGGGGCACGCTGGAGTAG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1200081179 X:153577236-153577258 CAGCAGAAGCCCAGCCTGGAAGG 0: 1
1: 0
2: 7
3: 42
4: 380
1200081172_1200081174 -10 Left 1200081172 X:153577189-153577211 CCGGGAGGGGCACGCTGGAGTAG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1200081174 X:153577202-153577224 GCTGGAGTAGCCGGTGAGACCGG 0: 1
1: 0
2: 0
3: 14
4: 148
1200081172_1200081181 29 Left 1200081172 X:153577189-153577211 CCGGGAGGGGCACGCTGGAGTAG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1200081181 X:153577241-153577263 GAAGCCCAGCCTGGAAGGAAGGG 0: 1
1: 0
2: 7
3: 47
4: 427
1200081172_1200081178 20 Left 1200081172 X:153577189-153577211 CCGGGAGGGGCACGCTGGAGTAG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1200081178 X:153577232-153577254 GTAGCAGCAGAAGCCCAGCCTGG 0: 1
1: 0
2: 1
3: 46
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200081172 Original CRISPR CTACTCCAGCGTGCCCCTCC CGG (reversed) Intronic
901548082 1:9974258-9974280 GTACTCCAGCCTGCCCAGCCAGG - Intronic
906143389 1:43546445-43546467 CTACTCCAACCTGCCCCTGCAGG - Intronic
906242464 1:44250479-44250501 CTGGTCCAGCCTGGCCCTCCTGG - Intronic
906343637 1:45002048-45002070 TTACTCCAGCCTGGGCCTCCTGG - Intergenic
907169969 1:52453305-52453327 TTACTCCAGCCTCCGCCTCCTGG - Intronic
907588894 1:55646873-55646895 CCAATCCAGGCTGCCCCTCCTGG - Intergenic
908432203 1:64070401-64070423 TTACTGCAGCCTGACCCTCCTGG + Intronic
908507011 1:64813996-64814018 CTACTGCAGCCTACACCTCCTGG + Intronic
912491344 1:110064443-110064465 CTGCACCAGCCTTCCCCTCCTGG - Intronic
916260232 1:162834546-162834568 CTAGTCCAGCCTGCCACTCCTGG - Intronic
916685835 1:167144827-167144849 TTACTCCAGCCTCCACCTCCTGG - Intergenic
920934464 1:210418279-210418301 CTACAGCAGCATCCCCCTCCTGG + Exonic
922864942 1:228851991-228852013 CTGCTCCCGCTTTCCCCTCCTGG - Intergenic
922870494 1:228898527-228898549 CTTTTCCAGAGTGACCCTCCTGG + Intergenic
924955910 1:248926451-248926473 CTACTACAGCTTGCAGCTCCTGG - Intergenic
1070289231 10:75103935-75103957 CTACTCCATCTGGCTCCTCCTGG - Intronic
1070691914 10:78533341-78533363 CTGCTCCCCCGTGACCCTCCAGG + Intergenic
1077075386 11:698891-698913 ATCCTGCTGCGTGCCCCTCCAGG + Intronic
1078334153 11:10450827-10450849 CTCCTCCCGCGGGGCCCTCCTGG + Exonic
1081861192 11:46334118-46334140 CCACTCCAGCTGGCTCCTCCAGG - Intronic
1085388674 11:76171311-76171333 CTGCTCCATCGGGCCCTTCCAGG - Intergenic
1089263198 11:117237152-117237174 CTACTGCAGCCTCCACCTCCTGG + Intronic
1097878034 12:64661754-64661776 CTACTGCAGCCTCCACCTCCTGG + Intronic
1103843741 12:123887058-123887080 CTCCTCCAGCGTCCCCACCCCGG + Intronic
1104190808 12:126480196-126480218 TCTCTCCAGGGTGCCCCTCCTGG - Intergenic
1105007573 12:132730738-132730760 CCACTGCAGCCTCCCCCTCCTGG - Intronic
1105031577 12:132887702-132887724 CTACTCTCGCGGGCCACTCCCGG - Intronic
1105407025 13:20141836-20141858 CTCCTCCATCGTCCACCTCCTGG + Exonic
1105763979 13:23540155-23540177 CTACTGCACCGTCCACCTCCTGG - Intergenic
1106128814 13:26922505-26922527 CTTCTCCAGCCTGGCTCTCCCGG + Intergenic
1106259922 13:28057548-28057570 GTACTCCAGCGTTCCCCGACTGG + Intronic
1109079179 13:57876213-57876235 CACTTCCAGCTTGCCCCTCCTGG + Intergenic
1115100175 14:29688856-29688878 CTACTCCAGCCTCCACCTCCCGG - Intronic
1119615559 14:76096555-76096577 CCATTCCCTCGTGCCCCTCCTGG - Intergenic
1120338075 14:83184724-83184746 CTGTTCCAGCATGCCCCTCTGGG + Intergenic
1122179378 14:99944251-99944273 CTGCTCCACCATGGCCCTCCTGG - Intergenic
1122215882 14:100203954-100203976 CTACTGCAGCTTCCACCTCCTGG - Intergenic
1127065573 15:55234313-55234335 CTACTCCAACCTCACCCTCCTGG + Intronic
1128127682 15:65204942-65204964 TTACTCCAGCCTCCGCCTCCTGG - Intronic
1128944711 15:71812484-71812506 GTTCTCCAGCCTGCCCTTCCGGG + Exonic
1129726355 15:77903662-77903684 CTAGTCCTGCGTGTCCCTCAAGG - Intergenic
1130344910 15:83034011-83034033 TTACTCCAGCGTCAACCTCCTGG - Intronic
1130610900 15:85360137-85360159 CTACTCCTGCTTGCCCTTTCTGG - Intergenic
1132813159 16:1811636-1811658 CTACTGCAGCCTCCGCCTCCCGG - Intronic
1134278465 16:12797478-12797500 CCACTGCAGCCTCCCCCTCCTGG - Intronic
1136114942 16:28088599-28088621 CTACTCCAACCTCCGCCTCCCGG - Intergenic
1138961872 16:62037090-62037112 CAACTACTGCGCGCCCCTCCTGG - Intergenic
1138998324 16:62478740-62478762 CTGCTCCAGCCTGCAGCTCCTGG - Intergenic
1139424838 16:66873259-66873281 CTCCTACAGCATGCGCCTCCTGG + Intergenic
1141439001 16:84017144-84017166 CTACCCCATCGTGCTCTTCCTGG - Exonic
1142182594 16:88678486-88678508 CTTCTCCCGCATGTCCCTCCTGG - Exonic
1143767083 17:9144913-9144935 CTCCTCAAGTGTGCCTCTCCAGG - Intronic
1144742833 17:17593675-17593697 CTACTCCAGCCTACCCAACCTGG + Intergenic
1146080168 17:29772827-29772849 TTACTCCAGTGAACCCCTCCAGG + Intronic
1146280679 17:31542248-31542270 CTAGCCCAGCTGGCCCCTCCAGG + Intergenic
1147628139 17:41913189-41913211 CTATTCCAGGCTGACCCTCCAGG + Intronic
1147967231 17:44199784-44199806 CCACTCCAGCCCGCCTCTCCCGG + Intronic
1151815897 17:76471240-76471262 CTACTGGAGCGTGCCCTTGCTGG - Exonic
1151975712 17:77482679-77482701 TTGCTCCAGCCTGGCCCTCCAGG + Intronic
1152320019 17:79603499-79603521 CTGCTCCAGGGAGCCCTTCCAGG + Intergenic
1152941790 17:83176706-83176728 TTTCCCCAGCCTGCCCCTCCAGG + Intergenic
1154244091 18:12679979-12680001 CCACTGCAGCCTCCCCCTCCTGG - Intronic
1159308298 18:66674537-66674559 CAACTTCAGCGAACCCCTCCTGG + Intergenic
1161738861 19:6008060-6008082 CAGCTCCTGCGTGTCCCTCCCGG - Intronic
1162946855 19:14049182-14049204 CGACTCCAAGATGCCCCTCCAGG + Exonic
1163426990 19:17245456-17245478 CGCCTCTAGCGTGCCCCTCCCGG - Exonic
1163752015 19:19083786-19083808 CTGCCCCAGCATGCACCTCCTGG + Intronic
1163752040 19:19083886-19083908 CCACCCCAGCATGCCCCTGCAGG + Intronic
1163752060 19:19083946-19083968 CCACCCCAGCGTGCCCCTGCAGG + Intronic
1163752077 19:19084006-19084028 CCACCCCAGCATGCCCCTGCAGG + Intronic
1163752095 19:19084066-19084088 CCACCCCAGTGTGCCCCTGCAGG + Intronic
1164515180 19:28928200-28928222 CAACTCCAGCCTCCCCCTCCAGG - Intergenic
1164700211 19:30279652-30279674 CTTCTCCAGTGTGCACCCCCTGG - Intronic
1165110414 19:33498915-33498937 CCACCCCAGGCTGCCCCTCCAGG + Intronic
1167199363 19:48053694-48053716 CTACTCTAGCCTGCCTCTCCTGG + Intronic
1167377560 19:49119861-49119883 GGACTCAGGCGTGCCCCTCCCGG + Intronic
1167710192 19:51105709-51105731 CTAACCCAGCGTGCTTCTCCTGG + Intronic
925888395 2:8412956-8412978 CTTCTCCAGCCTGCCTCTCAAGG - Intergenic
926149974 2:10420032-10420054 CTGCTCCAGCTTGCCCCGCGAGG - Exonic
926505302 2:13706759-13706781 CTACTCCAGGGTGCCTTTTCAGG + Intergenic
927639566 2:24838182-24838204 CATCTCCAGCGGCCCCCTCCTGG + Intronic
927945199 2:27131424-27131446 CTGCTCCAGAGTGCCTTTCCAGG - Exonic
932513581 2:72321458-72321480 CTACTCCACCCTCCACCTCCTGG - Intronic
933781839 2:85807905-85807927 CTACTTCAGAGGGCCCCTCTGGG - Intergenic
934735054 2:96685846-96685868 TTAGGCCAGCGTGCCCCTCCTGG - Intergenic
935734809 2:106097975-106097997 TTCCTCCAGTGTGCCCTTCCTGG - Intronic
937298566 2:120824519-120824541 CGGCTCCAGAGTGTCCCTCCAGG + Intronic
938427289 2:131202494-131202516 CTGCACCAGCCTGGCCCTCCTGG + Intronic
938468234 2:131536542-131536564 CTGCACCAGCCTGGCCCTCCTGG + Intergenic
939928356 2:148201494-148201516 CTGCTCTAGCCTGCACCTCCAGG + Intronic
941312860 2:163955727-163955749 CTCCTCCAGACTGCCCCTCAAGG - Intergenic
944770873 2:202912661-202912683 CTTCTCCAGCCTGCCCCTCTGGG - Intronic
946958170 2:224955053-224955075 CTACTCCAGCTTCCCACTACTGG + Intronic
947668009 2:231919159-231919181 GGACTCCAGCGAGCCCCACCTGG + Intergenic
947764122 2:232624910-232624932 CGACTCCATGATGCCCCTCCTGG + Intronic
1168834118 20:865775-865797 CTACTCCAGTGTGGACCACCAGG - Intergenic
1170473189 20:16688601-16688623 CTACTCCACCCAGCTCCTCCTGG - Intergenic
1172607574 20:36224894-36224916 TTACTCCAGCCTCCACCTCCCGG + Intronic
1174194081 20:48760636-48760658 CTAGTCCAGCCTCCCTCTCCTGG - Intronic
1175079741 20:56409118-56409140 CTACTGCAGCCTCCACCTCCCGG + Intergenic
1176303537 21:5111398-5111420 GTACTCCAGCCAGGCCCTCCTGG + Intergenic
1177279795 21:18966563-18966585 TCACTGCAGCGTCCCCCTCCTGG + Intergenic
1178404311 21:32311858-32311880 CTCCTCCACCTTGCCCCTCGGGG + Exonic
1179853493 21:44150552-44150574 GTACTCCAGCCAGGCCCTCCTGG - Intergenic
1179979919 21:44890553-44890575 CTGCTCCTGCGTGCCCCACATGG + Intronic
1182430962 22:30298713-30298735 CTCCTCCAGCCTGCTCCCCCAGG - Intronic
1183096291 22:35554189-35554211 CTCCTTCAGCCTGGCCCTCCTGG + Intergenic
950343684 3:12272362-12272384 CCACCCCAGCTTGCCCTTCCTGG + Intergenic
954740649 3:52747378-52747400 TTACTGCAGCCTCCCCCTCCCGG - Intronic
954750955 3:52813450-52813472 CCACTCCCGGGGGCCCCTCCTGG + Exonic
954858905 3:53671035-53671057 CATCTCCAGCCTTCCCCTCCAGG + Intronic
961825180 3:129595537-129595559 TTTCTCCAACGTGCTCCTCCAGG - Intronic
969376494 4:6766901-6766923 TCACTACAGCCTGCCCCTCCTGG + Intergenic
971860090 4:32090748-32090770 CTGCTCCAGCCTGCAGCTCCTGG + Intergenic
972564698 4:40259259-40259281 TCACTGCAGCCTGCCCCTCCTGG - Intergenic
972678339 4:41281875-41281897 CTACTTCAGCCTCCACCTCCTGG + Intergenic
973234204 4:47880337-47880359 CCACTGCAGCCTGCACCTCCTGG - Intronic
976178907 4:82380972-82380994 CTGCTCCAGCCTGCGGCTCCTGG + Intergenic
982109556 4:152041389-152041411 TTCCTCCAGCGTCTCCCTCCTGG + Intergenic
982258853 4:153476031-153476053 CTACTGCAACCTCCCCCTCCTGG + Intronic
982292553 4:153793038-153793060 CTCCTCCAGCGCGCCCCTTCAGG - Intergenic
983339067 4:166434719-166434741 CTCCTCCATCCTGCCCCTCATGG + Intergenic
983392079 4:167145072-167145094 CAACTCCAGCATGACCATCCTGG - Intronic
985708352 5:1414406-1414428 CTTCTCCGCCCTGCCCCTCCAGG - Intronic
986292395 5:6410646-6410668 CTCCTCCACCGTGCAGCTCCGGG + Intergenic
986829698 5:11561969-11561991 TTACTGCAGCCTCCCCCTCCTGG - Intronic
991952139 5:71956684-71956706 TCAGTCCCGCGTGCCCCTCCCGG + Intergenic
999304938 5:150513421-150513443 TCACTCCAGCCTTCCCCTCCTGG - Intronic
1002644826 5:180647988-180648010 CTCCTCCAGGGTTCCCCTCCCGG + Intronic
1006951164 6:37821906-37821928 TTACTGCAGCCTGCACCTCCCGG + Intronic
1007219209 6:40265202-40265224 CTGCTCCAGAGTGCCCCACCAGG + Intergenic
1007409305 6:41652689-41652711 CTACTACAGCCTCCACCTCCTGG + Intronic
1007450088 6:41935916-41935938 CCACTCCAGAGGGCCTCTCCAGG + Exonic
1012913057 6:105138148-105138170 CTTGTCCAGTGTGCACCTCCAGG - Intergenic
1018872647 6:167795458-167795480 CTCCTCCCGCGTCCCCCTCGTGG + Intronic
1019055774 6:169222271-169222293 CTACTCCGGCGTGTCCCTCAAGG - Exonic
1019667362 7:2258555-2258577 GTTCTCCTCCGTGCCCCTCCTGG - Intronic
1020470646 7:8530633-8530655 CTCCTCCCTCATGCCCCTCCAGG - Intronic
1022629522 7:32071590-32071612 CTACTCAAGAGGGTCCCTCCTGG + Intronic
1024616873 7:51122902-51122924 CTACTGCAGCCTCCTCCTCCTGG - Intronic
1024749312 7:52446145-52446167 CCACTCAAGAGTGCCCCTCCTGG + Intergenic
1024868098 7:53926923-53926945 CTGCTCCAGGGTGCTGCTCCTGG + Intergenic
1025639604 7:63354128-63354150 CTCCTCCACCGAGCTCCTCCAGG + Intergenic
1025643095 7:63393964-63393986 CTCCTCCACCGAGCTCCTCCAGG - Intergenic
1026011251 7:66638331-66638353 CTATGCCATCGGGCCCCTCCTGG + Exonic
1029422650 7:100479120-100479142 CTCCTCCCGCGTGACCCTGCTGG + Exonic
1030289691 7:107859684-107859706 CTACTCCACCATGCTGCTCCCGG - Intergenic
1031585932 7:123532795-123532817 CTTCTCCAGCCTGCCCCTCTGGG + Exonic
1032357428 7:131223839-131223861 TTACTCCAGCCTCCGCCTCCTGG + Intronic
1034964710 7:155383990-155384012 CTACACCTGGGTGCCCCTCCTGG - Intronic
1035433852 7:158843167-158843189 TTACTGCAGCGTCCACCTCCCGG + Intergenic
1037823560 8:22147477-22147499 CACCCCCAGCGTGCCCCCCCCGG - Exonic
1039947678 8:42143924-42143946 CTACTGCAGCCTTCACCTCCCGG - Intergenic
1040599544 8:48870323-48870345 CTGCTCCAGCGCGCGCCGCCCGG - Intergenic
1042821785 8:72937340-72937362 ATACTCCAGCGTGCCATCCCTGG - Exonic
1045038161 8:98193726-98193748 TTACTGCAGCCTCCCCCTCCCGG - Intronic
1045673859 8:104588219-104588241 CTTCTCCCGCGTGCTGCTCCCGG + Intronic
1046830589 8:118741572-118741594 CCACTCCAGCATGCCCCACTGGG + Intergenic
1048987228 8:139741102-139741124 CTCCTCCAGCCTGCCCCAGCAGG + Intronic
1049153844 8:141055261-141055283 CTGCTCCAGCTTGGCCCTCAGGG + Intergenic
1051681152 9:19609337-19609359 CTATGGCAGTGTGCCCCTCCAGG + Intronic
1051855464 9:21559778-21559800 CCACTCCCGCGCGCCCCTCTCGG - Intergenic
1053606668 9:39666917-39666939 CTACTGCAGCGGTCCCTTCCAGG - Intergenic
1054246867 9:62675487-62675509 CTACTGCAGCGGTCCCTTCCAGG + Intergenic
1057769830 9:97957861-97957883 CTACTGCAACGTCCGCCTCCAGG - Intergenic
1061496845 9:130979953-130979975 CTGCCCCAGCCTGCCCCGCCAGG - Intergenic
1062252796 9:135606649-135606671 CTACTCGAGCGAGCCCCGCCGGG - Intergenic
1062717312 9:138017751-138017773 AAACTCCAGGGTGGCCCTCCAGG + Intronic
1188257576 X:27981247-27981269 CTACTCCAGACTGCTCCTCTGGG + Exonic
1190595421 X:52048520-52048542 CTACTCCAGTGTGCCCGTGTTGG + Intergenic
1190613403 X:52205553-52205575 CTACTCCAGTGTGCCCGTGTTGG - Intergenic
1192317664 X:70065601-70065623 CTTCTCCAGCCTGCCCCAGCTGG - Intergenic
1198807293 X:140504732-140504754 CTACTCTTGCCTGCGCCTCCCGG + Exonic
1200081172 X:153577189-153577211 CTACTCCAGCGTGCCCCTCCCGG - Intronic
1201299048 Y:12490328-12490350 CTACTCCAACCTCCTCCTCCTGG + Intergenic