ID: 1200083664

View in Genome Browser
Species Human (GRCh38)
Location X:153592254-153592276
Sequence GTCGCCGGTGTCCCGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 1, 2: 0, 3: 11, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200083664_1200083673 12 Left 1200083664 X:153592254-153592276 CCTCCTCCCGGGACACCGGCGAC 0: 1
1: 1
2: 0
3: 11
4: 126
Right 1200083673 X:153592289-153592311 CAGCACTCCTGTTCGACATCCGG 0: 1
1: 0
2: 0
3: 8
4: 119
1200083664_1200083676 25 Left 1200083664 X:153592254-153592276 CCTCCTCCCGGGACACCGGCGAC 0: 1
1: 1
2: 0
3: 11
4: 126
Right 1200083676 X:153592302-153592324 CGACATCCGGGACCCCTAAATGG 0: 1
1: 0
2: 0
3: 0
4: 39
1200083664_1200083674 13 Left 1200083664 X:153592254-153592276 CCTCCTCCCGGGACACCGGCGAC 0: 1
1: 1
2: 0
3: 11
4: 126
Right 1200083674 X:153592290-153592312 AGCACTCCTGTTCGACATCCGGG 0: 1
1: 0
2: 0
3: 6
4: 67

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200083664 Original CRISPR GTCGCCGGTGTCCCGGGAGG AGG (reversed) Intronic
900117241 1:1033921-1033943 GACGCCGGGGTCCCTGGAGGCGG + Intronic
900935926 1:5766396-5766418 GCAGCCGGGGACCCGGGAGGAGG - Intergenic
901887032 1:12230338-12230360 GACGCAGGGGTCCCCGGAGGTGG - Intronic
903078020 1:20787054-20787076 GGCGCCCGGGTCCCCGGAGGTGG - Intronic
903234044 1:21937942-21937964 GTCTCCTGTGTCCCTGGTGGAGG - Intergenic
903828628 1:26161899-26161921 GTCGCTGGCGTCCCCGGAGCCGG - Exonic
906211828 1:44016485-44016507 GTCCCCGGCGTCCAGGGATGAGG + Intronic
908195505 1:61742775-61742797 GTCCGCGCTGACCCGGGAGGCGG + Intronic
919977989 1:202625446-202625468 GTTGCCAGTGTGCGGGGAGGGGG + Intronic
920237287 1:204516528-204516550 GTCGGCGGGGTGCCGGGAGCGGG + Intronic
920920300 1:210292656-210292678 GGCACAGGTGTCCCAGGAGGGGG + Intergenic
923191865 1:231627283-231627305 GGCGCAGGTGTCCCAGGACGGGG - Intronic
1067562169 10:47311767-47311789 CTGGCTGGTGTCCCGGAAGGTGG - Intronic
1071537287 10:86444650-86444672 GTTGCCAGTGCCCAGGGAGGAGG + Intronic
1073112735 10:101072225-101072247 GCCGGCTGTGTCCTGGGAGGAGG + Intergenic
1078907366 11:15699998-15700020 GTCCCAGGAGTCCAGGGAGGGGG - Intergenic
1083448457 11:62726808-62726830 GCCGCCGGAGCCCCCGGAGGCGG - Exonic
1092522644 12:9290089-9290111 ATAGCCGGTCTTCCGGGAGGTGG + Intergenic
1092544641 12:9441808-9441830 ATAGCCGGTCTTCCGGGAGGTGG - Intergenic
1092899468 12:13044723-13044745 GTCGCCGCTGTCCCGAGGGGAGG + Intronic
1093077711 12:14774611-14774633 GGCGCCGGTGTACCTGGCGGCGG + Exonic
1094508308 12:31080262-31080284 ATAGCCGGTCTTCCGGGAGGTGG + Intronic
1096118311 12:49069394-49069416 GTCGCAGGTGTCCTGGGGCGGGG - Intronic
1096983683 12:55743259-55743281 GACGCCGGAGTCCCGCGGGGAGG - Exonic
1104505987 12:129332843-129332865 GTTACCGGTGTCTGGGGAGGAGG + Intronic
1104810393 12:131616962-131616984 GGAGCCTGTGTCCTGGGAGGCGG - Intergenic
1104933879 12:132354378-132354400 GCAGACGGTGTCCCGCGAGGAGG + Intergenic
1106283685 13:28300282-28300304 GTCACAGGTGTCCCTGGGGGTGG - Intergenic
1112050711 13:95642063-95642085 GGCGGCGGCGGCCCGGGAGGCGG - Exonic
1113597681 13:111546300-111546322 GCCGCAGGCTTCCCGGGAGGAGG + Intergenic
1113955083 13:114096054-114096076 GGCACTGGTGTGCCGGGAGGGGG + Intronic
1116039101 14:39664028-39664050 GGCGCTGGTGTCCCGGCTGGAGG + Intergenic
1121074898 14:91060162-91060184 GCCCCGGGGGTCCCGGGAGGTGG - Intronic
1121092737 14:91194186-91194208 GTCGCGGTAGTCCTGGGAGGTGG + Intronic
1121108827 14:91298285-91298307 GTTGCCGGGAACCCGGGAGGCGG + Intronic
1121218492 14:92266919-92266941 ATCGCCTGAGTCCGGGGAGGTGG - Intergenic
1122549144 14:102540414-102540436 CTGGCAGGTGTCCCGGCAGGAGG + Intergenic
1122923511 14:104889671-104889693 GTCGTCCGTGTCCCGGGGGCCGG - Exonic
1122989161 14:105228717-105228739 GACGGCAGGGTCCCGGGAGGTGG + Intronic
1123702838 15:22928467-22928489 GCCGCCATTTTCCCGGGAGGAGG - Intronic
1123783423 15:23647084-23647106 GCCATCGGTGTCCCCGGAGGTGG + Exonic
1123783434 15:23647114-23647136 GCCATCGGTGTCCCCGGAGGGGG + Exonic
1123783445 15:23647144-23647166 GCCATCGGTGTCCCCGGAGGGGG + Exonic
1124045777 15:26148648-26148670 GCCACCGTTGTCCTGGGAGGAGG - Intergenic
1124493597 15:30173370-30173392 GTTGCCAGTGTGCGGGGAGGGGG + Intergenic
1124749971 15:32365279-32365301 GTTGCCAGTGTGCGGGGAGGGGG - Intergenic
1132778732 16:1611410-1611432 ATCGCCTGAGCCCCGGGAGGCGG + Intronic
1132953324 16:2577244-2577266 GGCGCCGGTGTCCAGGGATCAGG + Intronic
1132975501 16:2709301-2709323 GTCTCCGGTCTCCCGGGATGGGG - Intergenic
1134039989 16:11060967-11060989 GTTGCCGCTGACTCGGGAGGAGG + Exonic
1137988136 16:53127854-53127876 GAGGTTGGTGTCCCGGGAGGTGG + Intronic
1138497295 16:57416263-57416285 GTTGGCGGGGTCCTGGGAGGCGG + Intergenic
1139432120 16:66916408-66916430 GTTGCCGCTGCCCCGTGAGGGGG - Exonic
1140442828 16:74999892-74999914 GTCGCCGGTGCCCCGGGAGGCGG - Exonic
1142814238 17:2412749-2412771 CTCACCAGTGTCCCAGGAGGGGG + Intronic
1144565075 17:16353217-16353239 GTCGCCGCGGGCCCAGGAGGAGG - Exonic
1145214854 17:21043368-21043390 GCCGCCAGGGTCCCGGGAGGCGG - Intronic
1147285737 17:39401569-39401591 GCCGCCGGCGCCGCGGGAGGTGG - Exonic
1148113811 17:45162832-45162854 GTCACCAGTGGCCCTGGAGGAGG + Exonic
1148750280 17:49941578-49941600 TTCTCAGGTGTCCCGGGAGAGGG - Intergenic
1148945614 17:51259929-51259951 GTCGCCGCAGTCCCGGGGAGAGG - Exonic
1150166725 17:62951036-62951058 GTGGGCGGTGTTCCTGGAGGTGG - Intergenic
1151541761 17:74768211-74768233 CTCGCTGGTGTCACTGGAGGCGG - Exonic
1152162355 17:78676736-78676758 GTCTCCGGTGCACAGGGAGGGGG + Intronic
1152355355 17:79804192-79804214 CTAGCCGTTGCCCCGGGAGGAGG + Intergenic
1152406654 17:80101724-80101746 GTCGCCGGGGCCGCGGGTGGAGG + Intergenic
1152743560 17:82029164-82029186 GGCGCGGCTGTCCCTGGAGGAGG + Exonic
1158435814 18:57435268-57435290 GCCGCAGCTGCCCCGGGAGGCGG - Intergenic
1161342334 19:3750149-3750171 GTCGCCACTGTCCCTGGGGGTGG - Exonic
1163019048 19:14473038-14473060 GTCTCAGGTGTCCCGGAAAGAGG + Intronic
1163243307 19:16077044-16077066 GGCGCCGGGGTCCCGGGCCGAGG + Intronic
1163490889 19:17616664-17616686 GTCCCTGGTGTCCCTGGAGCAGG - Intronic
1166331346 19:42079737-42079759 CTCGCCGGTGGGCCAGGAGGAGG - Exonic
1166361415 19:42254283-42254305 GCCACCGGTGGCGCGGGAGGAGG + Intronic
1167209334 19:48123214-48123236 GTCCTTGGTGTCCAGGGAGGTGG + Exonic
1167596860 19:50432543-50432565 GACGCCTGGGTCCCGGGAGAAGG - Intergenic
1167792126 19:51689346-51689368 GCCGGCGGGGTCCAGGGAGGGGG + Intergenic
925321583 2:2974264-2974286 GTGGCCAGTGTCCGGGAAGGTGG - Intergenic
932422111 2:71607320-71607342 GTTGCGTGTGTCCCAGGAGGTGG + Intronic
934983947 2:98870552-98870574 GTCCCCTGTATCCTGGGAGGTGG + Intronic
937267990 2:120629441-120629463 GTGGCAGGTGTCCCAGGTGGGGG + Intergenic
947702527 2:232246419-232246441 GTTGCCAGTGCCCCGGGAGAGGG + Intronic
948158230 2:235801712-235801734 GCGGCCTGTGCCCCGGGAGGAGG + Intronic
948423692 2:237875378-237875400 GTCCCCGGGGTGCCCGGAGGAGG + Intronic
948892053 2:240912224-240912246 CTAGCTGGTGTCCAGGGAGGTGG - Intergenic
1172109305 20:32536191-32536213 GGCTGCGGTGCCCCGGGAGGCGG - Intronic
1175074054 20:56358960-56358982 CGCGCCGCTGACCCGGGAGGCGG - Exonic
1179965371 21:44801797-44801819 GTCCCCGGTGTCGGGGCAGGAGG - Exonic
1180100110 21:45579894-45579916 GACGCGGGTGCCCCGGGATGCGG + Intergenic
1181175467 22:21032444-21032466 GGCGCAGGTGTCCGGGGACGGGG - Intronic
1183647270 22:39134003-39134025 AGCGCAGGTGTCCAGGGAGGGGG + Exonic
1184766965 22:46577168-46577190 GGCGCCGGGGAGCCGGGAGGAGG - Intronic
1185304102 22:50103033-50103055 GTCACAGGTGTGGCGGGAGGAGG + Intronic
954297250 3:49681142-49681164 GTTGTGGGTGTCCCTGGAGGAGG + Exonic
954388799 3:50258358-50258380 GTCGGCGGTGGCCCTGGAGGTGG - Exonic
966402667 3:179563218-179563240 GAGGCCGGGGTCCCGAGAGGGGG - Intronic
968635423 4:1675942-1675964 TTTGCCGCTGTCCCGTGAGGCGG - Intronic
969603157 4:8188878-8188900 CTCTCCGGTGTCCCAGGGGGAGG + Intronic
981688519 4:147481263-147481285 GTGGCCGGTGTCCCGGGCTCCGG - Exonic
985628327 5:1001668-1001690 GTGGCAGGTGTCCTGGCAGGAGG + Intergenic
985881662 5:2642988-2643010 GTCGCCGGCATCCAGGGCGGTGG - Intergenic
989643267 5:43603432-43603454 GTCGGCGGTGTCCCGGGCGCAGG + Intronic
998349586 5:141492010-141492032 GTGTCGGGGGTCCCGGGAGGAGG + Intronic
999288249 5:150406989-150407011 GGCCCCGGTGCCCAGGGAGGAGG + Intronic
999353055 5:150895615-150895637 TTCGCTGGTGTCCCGGAAGGTGG + Exonic
1002785010 6:393506-393528 GTCGCCGGAGCCGCAGGAGGAGG + Intronic
1005482987 6:26272393-26272415 TGCGCCGGTGTACCTGGAGGCGG - Intergenic
1011448948 6:87472935-87472957 GTCCCCGGTGTCCTGCGCGGGGG + Intronic
1013424582 6:109999220-109999242 GTGGCTGGTGTCCTGGGAGTTGG + Intergenic
1019347509 7:538186-538208 GGAGCCGGGGTCCCTGGAGGAGG + Intergenic
1020212008 7:6164759-6164781 GTGGCTGGGGTCCTGGGAGGTGG - Exonic
1024262250 7:47581673-47581695 TTCGCCGGAGTCCGGGGACGGGG - Intronic
1026558554 7:71428922-71428944 GTGGCCGGTGTCCCTGGAAGTGG - Intronic
1026869886 7:73843952-73843974 GTTGCAGGTGTCCAGGCAGGAGG + Intergenic
1026904702 7:74056369-74056391 GTCGCAGGTGTCCCTGGTGTCGG + Exonic
1026904713 7:74056405-74056427 GTCGGAGGTGTCCCGGGAGTTGG + Exonic
1026909583 7:74084214-74084236 CTCGCCGGGGGCCGGGGAGGGGG - Intronic
1027116629 7:75486370-75486392 GCGGTGGGTGTCCCGGGAGGCGG - Intergenic
1029720878 7:102363776-102363798 GTGGTGGGTGTCCCGGGAGGCGG + Intergenic
1030820531 7:114086573-114086595 GTGGGCAGCGTCCCGGGAGGTGG - Intronic
1034219334 7:149431961-149431983 TGCGCCGGTGTTCCAGGAGGTGG + Exonic
1034488729 7:151381767-151381789 GTCACCGGTGACGCGGTAGGCGG + Intronic
1036167530 8:6450484-6450506 GTGGCTGGTATCCCTGGAGGTGG - Intronic
1039453633 8:37694876-37694898 GAGGCGGGTGTCCCTGGAGGGGG - Intergenic
1041580742 8:59456974-59456996 GTCGGCGGGGGCCAGGGAGGAGG - Intergenic
1045269508 8:100649777-100649799 GTGGCCGATGTCCGGGGTGGGGG - Intronic
1047202897 8:122781536-122781558 TTCGCCGGTGTCTCCGGAGGGGG + Exonic
1051171569 9:14322707-14322729 GGCGCCCGGGACCCGGGAGGCGG + Intronic
1051774932 9:20622635-20622657 GCCGCCGGGGTTTCGGGAGGTGG - Intergenic
1052756882 9:32550926-32550948 GTCTCCGCTGTCTCGCGAGGAGG - Exonic
1052917351 9:33933522-33933544 GTCGCCAGTGTGCTGGGATGTGG + Exonic
1056655999 9:88509654-88509676 GTGGGAGGTATCCCGGGAGGTGG - Intergenic
1060407672 9:123380996-123381018 GTCACCTGTGTCCGAGGAGGTGG + Exonic
1060963677 9:127699478-127699500 GTCGCCTCTGGCCCTGGAGGCGG + Intronic
1061084952 9:128393204-128393226 GGCGGCGGTGGCCCGGGCGGCGG + Intergenic
1062057373 9:134475565-134475587 CTGGGCCGTGTCCCGGGAGGCGG + Intergenic
1062574723 9:137200794-137200816 ATGGTCGGTGGCCCGGGAGGGGG - Exonic
1185505455 X:630089-630111 GGCGCTGGAGACCCGGGAGGCGG + Intronic
1200083664 X:153592254-153592276 GTCGCCGGTGTCCCGGGAGGAGG - Intronic