ID: 1200084807

View in Genome Browser
Species Human (GRCh38)
Location X:153598942-153598964
Sequence CAGGTAACCGCGGCCGGGGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200084807_1200084818 16 Left 1200084807 X:153598942-153598964 CCTCCCCCGGCCGCGGTTACCTG 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1200084818 X:153598981-153599003 CGCCACTCGGAAGTGCACCCTGG 0: 3
1: 1
2: 1
3: 5
4: 60
1200084807_1200084816 3 Left 1200084807 X:153598942-153598964 CCTCCCCCGGCCGCGGTTACCTG 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1200084816 X:153598968-153598990 CCATGATGAACCTCGCCACTCGG 0: 2
1: 3
2: 0
3: 3
4: 46
1200084807_1200084820 22 Left 1200084807 X:153598942-153598964 CCTCCCCCGGCCGCGGTTACCTG 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1200084820 X:153598987-153599009 TCGGAAGTGCACCCTGGCTTCGG 0: 3
1: 0
2: 1
3: 5
4: 91
1200084807_1200084822 29 Left 1200084807 X:153598942-153598964 CCTCCCCCGGCCGCGGTTACCTG 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1200084822 X:153598994-153599016 TGCACCCTGGCTTCGGGCGCCGG 0: 3
1: 1
2: 0
3: 10
4: 88
1200084807_1200084821 23 Left 1200084807 X:153598942-153598964 CCTCCCCCGGCCGCGGTTACCTG 0: 1
1: 0
2: 0
3: 18
4: 164
Right 1200084821 X:153598988-153599010 CGGAAGTGCACCCTGGCTTCGGG 0: 3
1: 1
2: 2
3: 3
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200084807 Original CRISPR CAGGTAACCGCGGCCGGGGG AGG (reversed) Exonic
900239548 1:1608902-1608924 TAGGTAACTGCGGCCGGGCACGG + Intergenic
901309108 1:8255291-8255313 CAGGGAACCCTGGCCGGGCGAGG - Intergenic
901496984 1:9627882-9627904 CAGGGAACAGAGGCCGCGGGTGG + Intergenic
904268096 1:29329444-29329466 GAGGTCACCGGGGCAGGGGGAGG - Intergenic
905905955 1:41618663-41618685 CAGGTCACTGGGGCCTGGGGTGG - Intronic
906168962 1:43707768-43707790 CCGGGACCCGCGGCCGGCGGGGG - Intronic
911144822 1:94541858-94541880 CAAGTGACCCGGGCCGGGGGCGG - Intergenic
911887971 1:103327501-103327523 CAGGTAGCTGCTGCTGGGGGTGG + Intergenic
914431104 1:147620662-147620684 CAGTTCAGCGCGGCCTGGGGCGG + Exonic
914834957 1:151199079-151199101 CAGGTAAGCCCGGCAGGGCGTGG + Exonic
919005673 1:191896576-191896598 CATGTAACCACGGCCGAGAGAGG - Intergenic
1063200901 10:3784893-3784915 CAGGTAAACGCAGCCGGCCGCGG - Exonic
1064408934 10:15088697-15088719 CAGGTACCCGGGGCGCGGGGAGG - Exonic
1065975206 10:30835816-30835838 CAGGAAAGTGAGGCCGGGGGAGG + Intronic
1069692232 10:70361448-70361470 CAGGTAACTGAGGCAGGGGCAGG + Intronic
1074399078 10:113126879-113126901 ATGGTAAGCGCGGCCGGCGGCGG + Intronic
1075999909 10:126905897-126905919 CAGATAGCAGCGGCCGGGGCCGG - Intronic
1076027990 10:127132595-127132617 CAGGTGACCGCGGCTGGGATAGG + Intronic
1076218882 10:128717321-128717343 GAGGGAACCGCGGCCATGGGAGG + Intergenic
1077011538 11:381301-381323 CAGGACCCCGGGGCCGGGGGCGG - Intronic
1077011553 11:381333-381355 CAGGACCCCGGGGCCGGGGGCGG - Intronic
1077011567 11:381365-381387 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077011582 11:381397-381419 CAGGACCCCGGGGCCGGGGGCGG - Intronic
1077011596 11:381429-381451 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077011611 11:381461-381483 CAGGACCCCGGGGCCGGGGGCGG - Intronic
1077011625 11:381493-381515 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077011640 11:381525-381547 CAGGACCCCGGGGCCGGGGGCGG - Intronic
1077011654 11:381557-381579 CAGGAACCCGGGGCCGGGGGCGG - Intronic
1077011669 11:381589-381611 CAGGACCCCGGGGCCGGGGGCGG - Intronic
1077124130 11:925079-925101 CCAGTGACAGCGGCCGGGGGCGG - Intronic
1079366478 11:19814386-19814408 CAGGTCACCCTGGCCAGGGGAGG - Intronic
1081938173 11:46918668-46918690 CAGGGAGCCGGGGCCGAGGGCGG - Intergenic
1083272834 11:61580770-61580792 CAGGTAAGCGCGGCCCCGGCGGG - Exonic
1090788346 11:130069556-130069578 CAGATAACCGCGCCGGGGGGCGG + Intergenic
1091749724 12:3014790-3014812 CAGGAAACCGCGGCCTGGGCAGG - Intronic
1094107971 12:26833305-26833327 CAGGGAGCAGCGGCCGGGGGCGG + Intergenic
1095710735 12:45285451-45285473 AAGGCTACCGAGGCCGGGGGCGG + Intronic
1096302637 12:50445009-50445031 CAGCTAACTCGGGCCGGGGGTGG - Intronic
1098369179 12:69739029-69739051 CAGGTGAGTGCGGCCGCGGGAGG + Intronic
1098541757 12:71664578-71664600 CAGGTAACCTGGGCAGGGAGTGG + Exonic
1102192930 12:111002556-111002578 AAGGTAACATCGGCCGGGTGTGG - Intergenic
1103180700 12:118908816-118908838 CAGGTAACTGGGGCATGGGGTGG - Intergenic
1103416869 12:120748106-120748128 CAGCTACTCGGGGCCGGGGGTGG + Intergenic
1103671141 12:122616549-122616571 CAGGAAATCTCGGCCGGGTGCGG - Intronic
1103944407 12:124518069-124518091 TGGGTCACCCCGGCCGGGGGAGG - Intronic
1105808852 13:23975970-23975992 CAAGTAACTGGGGCCGGGAGTGG - Intergenic
1113895020 13:113759025-113759047 CAGGACGCCGCGGCCGGGAGTGG - Intergenic
1114401943 14:22418129-22418151 CAGGAAACCGAGGCCTGGTGTGG + Intergenic
1114559754 14:23581033-23581055 CAGGAGCCCACGGCCGGGGGAGG - Intergenic
1114623549 14:24114074-24114096 CCTGGACCCGCGGCCGGGGGCGG + Intronic
1119046164 14:71320649-71320671 CAGGTAAGTGCGGACGGGGGCGG - Intronic
1119635240 14:76268005-76268027 CGGGGAGCCGGGGCCGGGGGCGG + Intergenic
1122145188 14:99684534-99684556 CAGGTGAGCGGGGCTGGGGGCGG + Exonic
1122189619 14:100030390-100030412 GAGGTAATCTCGGCCGGGCGCGG - Intronic
1122624199 14:103075782-103075804 CGGGGAAACGCGGCCGGAGGCGG - Intergenic
1125536113 15:40441754-40441776 CAAGGGGCCGCGGCCGGGGGCGG + Intronic
1129161973 15:73752394-73752416 CAGGTGACCGGGGCGCGGGGAGG + Exonic
1130335397 15:82953060-82953082 AAGGGAACCGAGGCCTGGGGAGG + Intronic
1132613634 16:829727-829749 CAGTTAACACCGGCCGGGGGTGG - Intergenic
1132659571 16:1055339-1055361 CAGGGAGCCGAGGCCCGGGGTGG + Intergenic
1132951623 16:2565695-2565717 CAGGTAACCGCGGGGGTGGCTGG + Exonic
1132962727 16:2634475-2634497 CAGGTAACCGCGGGGGTGGCTGG - Intergenic
1133188194 16:4115460-4115482 CTGGTGACCCCGGCCGGGGCAGG - Exonic
1134451682 16:14367787-14367809 AAGGTAGCCACGGCCGGGCGCGG + Intergenic
1134642375 16:15839400-15839422 AAGGTAATGGCGGCCGGGCGCGG + Intronic
1136593222 16:31230434-31230456 AAGGTAACCGGAGCCGGGCGTGG + Intergenic
1138242049 16:55435295-55435317 CAGGAAACCGAGGCCCAGGGAGG + Intronic
1138453283 16:57106309-57106331 CAGGTCACAGGGGCAGGGGGCGG - Intronic
1138591243 16:58000696-58000718 CAGGGAGGCGGGGCCGGGGGAGG + Intronic
1139484362 16:67247596-67247618 GAGGTAACCACTGCCGGAGGCGG + Exonic
1140440849 16:74986281-74986303 CAGAAAACAGCGGCCGGGCGCGG - Intronic
1142426140 16:90003288-90003310 AAGGTAGCCCAGGCCGGGGGAGG - Intergenic
1142426187 16:90003453-90003475 AAGGTAGCCCGGGCCGGGGGAGG - Intergenic
1142426204 16:90003508-90003530 AAGGTAGCCCGGGCCGGGGGAGG - Intergenic
1142426219 16:90003563-90003585 AAGGTAGCCCGGGCCGGGGGAGG - Intergenic
1143140582 17:4739881-4739903 CAGGTGCGCGCGGCCGGGGCTGG - Intronic
1145265188 17:21376594-21376616 CAGATAACAGCCGGCGGGGGAGG + Exonic
1146788072 17:35735291-35735313 CAGGTAAAGGCGGCGGGCGGTGG - Exonic
1147862622 17:43532713-43532735 CAGGTACCCAGGGGCGGGGGTGG - Exonic
1147936590 17:44014775-44014797 CCGCTAAACGCGGCAGGGGGCGG - Intronic
1147950148 17:44102955-44102977 AAGGGAACCTGGGCCGGGGGCGG - Intronic
1148051054 17:44770062-44770084 CAGGGGACCGGGGCCGGGGATGG + Intronic
1149461596 17:56833939-56833961 CAGGGCACTGCGGCTGGGGGCGG - Intronic
1149894855 17:60421755-60421777 CAGGGACCCGAGGCCGAGGGCGG - Intronic
1149998418 17:61416928-61416950 CAGGGAAGCGCGGCCAGGGGAGG + Intergenic
1150633459 17:66896713-66896735 CAGATAGCCACGGCCGGGCGCGG - Intergenic
1150983473 17:70169403-70169425 CCGGGAACCGCGGCGGGGAGGGG - Intronic
1151556831 17:74850906-74850928 CAGGGACCCGAGGCTGGGGGAGG - Intronic
1151717879 17:75840639-75840661 CAGGTGGCTGCGGCCGGGGGTGG - Intronic
1151765784 17:76132587-76132609 CAGGTGACCGGGGCGGGCGGGGG - Intergenic
1152108198 17:78342621-78342643 GAGGAAACCGAGGCCGGGAGAGG - Intergenic
1152635997 17:81430766-81430788 GAGGAAACCGAGGCCGGGAGAGG - Intronic
1156448499 18:37253747-37253769 CAGGTAACCGGGGGCGGCCGGGG - Exonic
1157496758 18:48161967-48161989 CGGGTAACCGTGGGCAGGGGCGG - Intronic
1159699526 18:71607554-71607576 CAGCTAATCTCGGCCGGGCGCGG - Intergenic
1160577381 18:79864289-79864311 CGGGTGAGCGCGGCCGGGGGTGG + Exonic
1160776851 19:860555-860577 CAGGCAGCCTCGCCCGGGGGAGG + Intronic
1160873222 19:1286306-1286328 CAGGTGAGCGCGGCCGCGCGCGG + Exonic
1160897045 19:1407901-1407923 AAGGTCACGCCGGCCGGGGGCGG + Intronic
1160947973 19:1652280-1652302 CAGGTGAGCCCGGCGGGGGGCGG - Exonic
1161277851 19:3428803-3428825 CAGGAAACCCCGGTCGGGGGAGG + Intronic
1161504447 19:4636348-4636370 CCGGAACCCGCGGCCGGGGCGGG - Intergenic
1163313389 19:16527232-16527254 CAGGTACCCTCTGCTGGGGGGGG - Intronic
1166227885 19:41408309-41408331 GAGGAAACCGAGGCCTGGGGAGG - Intronic
1167052274 19:47086519-47086541 CAGGCAGCCGAGGCCGGGGCCGG - Exonic
1168144253 19:54410887-54410909 CAGGGAACCACGGCCGGAGAAGG + Intergenic
1168359353 19:55725734-55725756 CAGGGAACCCAGGCCGGGCGCGG + Intronic
1168717666 19:58538793-58538815 CAGGTGACAACGGCTGGGGGCGG - Intronic
925410820 2:3638975-3638997 GAGGTTACCGGGGCTGGGGGAGG - Intronic
926100715 2:10115315-10115337 AATGTAACAGCGGCCGGGTGCGG + Intergenic
928420974 2:31137820-31137842 CAGGTAACAGCCGCCGGATGTGG - Intronic
929641059 2:43580327-43580349 GAGGTAACTTCGGCCGGGTGTGG - Intronic
935371918 2:102356124-102356146 CTGCTAACCCCGGCCGGTGGAGG - Exonic
936441734 2:112559918-112559940 CACGTAACCTTGGCCGGGCGCGG - Intronic
936713626 2:115161481-115161503 TCGGCAACCGCAGCCGGGGGGGG - Intronic
942565851 2:177264454-177264476 TAGGGAACCGCGGCCCGGGAGGG - Intronic
948602417 2:239115033-239115055 CAGGTGACCGCAGGCGGGGAGGG - Exonic
1168804314 20:663569-663591 CAGGGAAACGCAGCCGGGGCTGG + Exonic
1172277244 20:33686354-33686376 CAGGCAGCGGCGGCCGGGGGCGG - Exonic
1174149904 20:48478561-48478583 CAGGGAACTGAGGCCGGGGAGGG - Intergenic
1174210098 20:48871261-48871283 CAGGGCACCTCGGCCGGGCGTGG + Intergenic
1174210167 20:48871867-48871889 CAGGGCACCTCGGCCGGGCGTGG + Intergenic
1178534872 21:33403287-33403309 CCGGGAACCGCGGCCCTGGGGGG - Exonic
1180959616 22:19756724-19756746 AAGGGAACCGCGGCCGGGCCAGG + Exonic
1182552599 22:31108309-31108331 TAGGCAACCACGGCCGGGCGTGG + Intronic
1183782924 22:40010122-40010144 CAGGTAAAGGACGCCGGGGGTGG + Intronic
1184337564 22:43862638-43862660 TGGGTGACCCCGGCCGGGGGCGG - Intergenic
1184681342 22:46073819-46073841 CAGCCAGCCGCGGCCGGAGGTGG + Intronic
1185349468 22:50327008-50327030 CGGGGAAACGCGGGCGGGGGCGG + Exonic
1203238351 22_KI270732v1_random:30399-30421 CAAGAAGCCGCGGCCGGCGGCGG - Intergenic
950171882 3:10844367-10844389 CAGCTAACCGTGGCAGGGGAAGG + Intronic
950487679 3:13282691-13282713 CAAGTAAGCGGGGCCCGGGGCGG - Intergenic
954552611 3:51494402-51494424 AAGGAAACCTCGGCCGGGCGCGG - Intronic
954691056 3:52395848-52395870 CAGGTAACTGGGGGTGGGGGTGG - Intronic
969600661 4:8174124-8174146 CAGGAAACCCAGCCCGGGGGAGG - Intergenic
971949772 4:33329841-33329863 AAGTTAACCTCGGCCGGGCGCGG - Intergenic
981348461 4:143700838-143700860 CAGGTAACGGCAGCGGGGGAAGG + Intergenic
982573173 4:157076051-157076073 CTGGCGACCGCGGGCGGGGGAGG - Exonic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
992330868 5:75716370-75716392 CAGGTAACAGGGGTGGGGGGGGG + Intronic
999411056 5:151350138-151350160 GAGGTACCCGGGGCCGGGGGAGG - Intergenic
1003868291 6:10382519-10382541 CAGGTGACTGCGGCAGGGGCAGG + Intergenic
1006429663 6:33988068-33988090 CAGGTACCCGGGGCCAGAGGGGG - Intergenic
1006634475 6:35452316-35452338 GAGGGAGGCGCGGCCGGGGGCGG - Intergenic
1008191434 6:48463031-48463053 GGGGTAACCTCGGCCGGGCGTGG - Intergenic
1013550389 6:111202183-111202205 CAGTTACCCACGGCCGGGTGTGG + Intronic
1019925814 7:4191242-4191264 CATGTGACCGCGGCGGGGGAGGG - Intronic
1020893814 7:13914173-13914195 GAGGTACCCCCGGCCGGGCGCGG - Intronic
1023435126 7:40134464-40134486 CGGGGAACCCCGGGCGGGGGCGG - Exonic
1024700598 7:51900965-51900987 CAGGAGCCCACGGCCGGGGGTGG + Intergenic
1027001780 7:74658640-74658662 CTGGTAACTGCGGCGGGCGGGGG + Intronic
1028984114 7:96996692-96996714 CAGGCAGCCCCGGCCGGGGCAGG + Intergenic
1029746357 7:102517626-102517648 CATGTGAGCGCGGCCGGGGGTGG - Exonic
1029764295 7:102616605-102616627 CATGTGAGCGCGGCCGGGGGTGG - Exonic
1031397645 7:121292810-121292832 CAGGTAAACAGGGCCTGGGGTGG - Intronic
1031627761 7:124009866-124009888 AAGGTAATGGCGGCCGGGCGCGG + Intergenic
1032070858 7:128805899-128805921 CAGGTAAACACTGCCCGGGGAGG + Exonic
1035602079 8:902776-902798 CAGGTGGGCGGGGCCGGGGGAGG + Intergenic
1038151064 8:24942521-24942543 CAGGTGGCCGCGCCCGGAGGAGG - Intergenic
1038176342 8:25184714-25184736 CAGGTGACCGCGGGCGGCGCGGG + Intronic
1039957298 8:42217486-42217508 CAGGAAACCGAGGCCCAGGGAGG + Intergenic
1043521320 8:81048524-81048546 CAGGTCACAGCGGCTGGGGCAGG - Intronic
1043847238 8:85177352-85177374 CAGGTGGCCGCGGGCGGGGCCGG + Intronic
1045098961 8:98825925-98825947 CCGGGCACCGCGGCGGGGGGCGG + Intronic
1049616375 8:143577447-143577469 CAGGTAACCGCCGTCTTGGGTGG - Intronic
1053050672 9:34958399-34958421 CCGGTAAGCGGGGGCGGGGGCGG + Exonic
1053697102 9:40649691-40649713 CAAATAACCGCGGCACGGGGCGG + Intergenic
1053943495 9:43279855-43279877 CAAATAACCGCGGCACGGGGCGG + Intergenic
1054308354 9:63448925-63448947 CAAATAACCGCGGCACGGGGCGG + Intergenic
1054440705 9:65258358-65258380 CAAATAACCGCGGCACGGGGCGG + Intergenic
1054489696 9:65763551-65763573 CAAATAACCGCGGCAGGGGGCGG - Intergenic
1056406709 9:86282294-86282316 GAGGTCACGGCGGCCGGGAGTGG - Intronic
1057045894 9:91886164-91886186 AAAGTAACCATGGCCGGGGGCGG - Intronic
1057188349 9:93071837-93071859 GAGGCAACCGCAGCCAGGGGTGG + Intronic
1061451314 9:130668351-130668373 CCGGTAAACCCGGCGGGGGGAGG + Intronic
1062472533 9:136712749-136712771 CAGGCAGAGGCGGCCGGGGGCGG - Intronic
1202779553 9_KI270717v1_random:23351-23373 CAAATAACCGCGGCACGGGGCGG + Intergenic
1203586615 Un_KI270747v1:9760-9782 CAAATAACCGCGGCACGGGGCGG + Intergenic
1185456648 X:314130-314152 CAGGTAACTCGGGCCGGGCGCGG - Exonic
1192580479 X:72277125-72277147 CGGGCAGCCCCGGCCGGGGGAGG + Intronic
1197599996 X:128517721-128517743 CAGGTAACCATGGCAGGGGCTGG - Intergenic
1198755056 X:139973926-139973948 TAGGTAACCAAGGCCGGGCGTGG + Intergenic
1200084807 X:153598942-153598964 CAGGTAACCGCGGCCGGGGGAGG - Exonic