ID: 1200085103

View in Genome Browser
Species Human (GRCh38)
Location X:153600169-153600191
Sequence CTGAGGAAGGAGAATGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200085103_1200085115 27 Left 1200085103 X:153600169-153600191 CCGGCCTCATTCTCCTTCCTCAG No data
Right 1200085115 X:153600219-153600241 AGTCCTCTCTCCATCCCAGCTGG No data
1200085103_1200085116 28 Left 1200085103 X:153600169-153600191 CCGGCCTCATTCTCCTTCCTCAG No data
Right 1200085116 X:153600220-153600242 GTCCTCTCTCCATCCCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200085103 Original CRISPR CTGAGGAAGGAGAATGAGGC CGG (reversed) Intergenic
No off target data available for this crispr