ID: 1200087017

View in Genome Browser
Species Human (GRCh38)
Location X:153611919-153611941
Sequence ACAGAAGCCCGGACGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200087017_1200087024 5 Left 1200087017 X:153611919-153611941 CCTGCTTCCGTCCGGGCTTCTGT No data
Right 1200087024 X:153611947-153611969 TGAGTAAGGCTGGTCTCCTGAGG No data
1200087017_1200087023 -5 Left 1200087017 X:153611919-153611941 CCTGCTTCCGTCCGGGCTTCTGT No data
Right 1200087023 X:153611937-153611959 TCTGTGGGAGTGAGTAAGGCTGG No data
1200087017_1200087022 -9 Left 1200087017 X:153611919-153611941 CCTGCTTCCGTCCGGGCTTCTGT No data
Right 1200087022 X:153611933-153611955 GGCTTCTGTGGGAGTGAGTAAGG No data
1200087017_1200087027 26 Left 1200087017 X:153611919-153611941 CCTGCTTCCGTCCGGGCTTCTGT No data
Right 1200087027 X:153611968-153611990 GGGAAGTGTGTGATTCTTGCCGG No data
1200087017_1200087028 27 Left 1200087017 X:153611919-153611941 CCTGCTTCCGTCCGGGCTTCTGT No data
Right 1200087028 X:153611969-153611991 GGAAGTGTGTGATTCTTGCCGGG No data
1200087017_1200087029 28 Left 1200087017 X:153611919-153611941 CCTGCTTCCGTCCGGGCTTCTGT No data
Right 1200087029 X:153611970-153611992 GAAGTGTGTGATTCTTGCCGGGG No data
1200087017_1200087025 6 Left 1200087017 X:153611919-153611941 CCTGCTTCCGTCCGGGCTTCTGT No data
Right 1200087025 X:153611948-153611970 GAGTAAGGCTGGTCTCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200087017 Original CRISPR ACAGAAGCCCGGACGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr