ID: 1200087958

View in Genome Browser
Species Human (GRCh38)
Location X:153619317-153619339
Sequence TTTTTTGTACAGATTGGGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200087948_1200087958 1 Left 1200087948 X:153619293-153619315 CCACCACACCCAGCTTTTTTTTT 0: 115
1: 1005
2: 13599
3: 66168
4: 147776
Right 1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG No data
1200087947_1200087958 10 Left 1200087947 X:153619284-153619306 CCACAGATGCCACCACACCCAGC No data
Right 1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG No data
1200087945_1200087958 28 Left 1200087945 X:153619266-153619288 CCTCCTGAGTAGCTGGAACCACA 0: 261
1: 7236
2: 60705
3: 181015
4: 228249
Right 1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG No data
1200087946_1200087958 25 Left 1200087946 X:153619269-153619291 CCTGAGTAGCTGGAACCACAGAT 0: 23
1: 648
2: 7905
3: 57523
4: 188889
Right 1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG No data
1200087950_1200087958 -7 Left 1200087950 X:153619301-153619323 CCCAGCTTTTTTTTTTTTTTTTG 0: 49
1: 1391
2: 10161
3: 40034
4: 115091
Right 1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG No data
1200087951_1200087958 -8 Left 1200087951 X:153619302-153619324 CCAGCTTTTTTTTTTTTTTTTGT 0: 35
1: 2547
2: 14787
3: 66943
4: 92041
Right 1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG No data
1200087949_1200087958 -2 Left 1200087949 X:153619296-153619318 CCACACCCAGCTTTTTTTTTTTT 0: 157
1: 861
2: 4909
3: 18087
4: 76046
Right 1200087958 X:153619317-153619339 TTTTTTGTACAGATTGGGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200087958 Original CRISPR TTTTTTGTACAGATTGGGGG GGG Intergenic
No off target data available for this crispr