ID: 1200088463

View in Genome Browser
Species Human (GRCh38)
Location X:153623398-153623420
Sequence CTGGCAGGAAGCAGAGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200088463_1200088478 25 Left 1200088463 X:153623398-153623420 CCCACCACTCTGCTTCCTGCCAG No data
Right 1200088478 X:153623446-153623468 CCTGTGTTTGCTCCCTCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200088463 Original CRISPR CTGGCAGGAAGCAGAGTGGT GGG (reversed) Intergenic
No off target data available for this crispr