ID: 1200089069

View in Genome Browser
Species Human (GRCh38)
Location X:153625947-153625969
Sequence GTGGCTCCACAGTTGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200089069_1200089077 -1 Left 1200089069 X:153625947-153625969 CCCAGGGCCAACTGTGGAGCCAC No data
Right 1200089077 X:153625969-153625991 CATGGTCTGAAGGAGGTGGAAGG No data
1200089069_1200089079 8 Left 1200089069 X:153625947-153625969 CCCAGGGCCAACTGTGGAGCCAC No data
Right 1200089079 X:153625978-153626000 AAGGAGGTGGAAGGAGAGTTGGG No data
1200089069_1200089078 7 Left 1200089069 X:153625947-153625969 CCCAGGGCCAACTGTGGAGCCAC No data
Right 1200089078 X:153625977-153625999 GAAGGAGGTGGAAGGAGAGTTGG No data
1200089069_1200089075 -5 Left 1200089069 X:153625947-153625969 CCCAGGGCCAACTGTGGAGCCAC No data
Right 1200089075 X:153625965-153625987 GCCACATGGTCTGAAGGAGGTGG No data
1200089069_1200089080 9 Left 1200089069 X:153625947-153625969 CCCAGGGCCAACTGTGGAGCCAC No data
Right 1200089080 X:153625979-153626001 AGGAGGTGGAAGGAGAGTTGGGG No data
1200089069_1200089074 -8 Left 1200089069 X:153625947-153625969 CCCAGGGCCAACTGTGGAGCCAC No data
Right 1200089074 X:153625962-153625984 GGAGCCACATGGTCTGAAGGAGG No data
1200089069_1200089082 28 Left 1200089069 X:153625947-153625969 CCCAGGGCCAACTGTGGAGCCAC No data
Right 1200089082 X:153625998-153626020 GGGGGACCCTCCTCTGCCTTAGG No data
1200089069_1200089081 10 Left 1200089069 X:153625947-153625969 CCCAGGGCCAACTGTGGAGCCAC No data
Right 1200089081 X:153625980-153626002 GGAGGTGGAAGGAGAGTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200089069 Original CRISPR GTGGCTCCACAGTTGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr