ID: 1200089244

View in Genome Browser
Species Human (GRCh38)
Location X:153626626-153626648
Sequence ATATGGATGTATCTTTCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200089244_1200089255 24 Left 1200089244 X:153626626-153626648 CCCACTGAAAGATACATCCATAT No data
Right 1200089255 X:153626673-153626695 GGGCCTTATATGCAAATAAAGGG No data
1200089244_1200089249 4 Left 1200089244 X:153626626-153626648 CCCACTGAAAGATACATCCATAT No data
Right 1200089249 X:153626653-153626675 ACACCCAGGCCCTGTGATCAGGG No data
1200089244_1200089254 23 Left 1200089244 X:153626626-153626648 CCCACTGAAAGATACATCCATAT No data
Right 1200089254 X:153626672-153626694 AGGGCCTTATATGCAAATAAAGG No data
1200089244_1200089248 3 Left 1200089244 X:153626626-153626648 CCCACTGAAAGATACATCCATAT No data
Right 1200089248 X:153626652-153626674 AACACCCAGGCCCTGTGATCAGG No data
1200089244_1200089246 -10 Left 1200089244 X:153626626-153626648 CCCACTGAAAGATACATCCATAT No data
Right 1200089246 X:153626639-153626661 ACATCCATATCTTAACACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200089244 Original CRISPR ATATGGATGTATCTTTCAGT GGG (reversed) Intergenic