ID: 1200091366

View in Genome Browser
Species Human (GRCh38)
Location X:153637626-153637648
Sequence CTTGAACTCCACCCTGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200091357_1200091366 16 Left 1200091357 X:153637587-153637609 CCACACCTGGGCTGGGGTGCACA No data
Right 1200091366 X:153637626-153637648 CTTGAACTCCACCCTGGTGGGGG No data
1200091358_1200091366 11 Left 1200091358 X:153637592-153637614 CCTGGGCTGGGGTGCACATGCTC No data
Right 1200091366 X:153637626-153637648 CTTGAACTCCACCCTGGTGGGGG No data
1200091356_1200091366 17 Left 1200091356 X:153637586-153637608 CCCACACCTGGGCTGGGGTGCAC No data
Right 1200091366 X:153637626-153637648 CTTGAACTCCACCCTGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200091366 Original CRISPR CTTGAACTCCACCCTGGTGG GGG Intergenic
No off target data available for this crispr