ID: 1200092039

View in Genome Browser
Species Human (GRCh38)
Location X:153640503-153640525
Sequence GACACCAGGAGGGCTGGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 630
Summary {0: 1, 1: 0, 2: 7, 3: 61, 4: 561}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200092031_1200092039 13 Left 1200092031 X:153640467-153640489 CCGGCAACGGATGGGTCTTGTTG 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG 0: 1
1: 0
2: 7
3: 61
4: 561
1200092034_1200092039 -10 Left 1200092034 X:153640490-153640512 CCTGGAGAGCAGAGACACCAGGA 0: 1
1: 0
2: 1
3: 41
4: 378
Right 1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG 0: 1
1: 0
2: 7
3: 61
4: 561
1200092030_1200092039 19 Left 1200092030 X:153640461-153640483 CCTCTTCCGGCAACGGATGGGTC 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG 0: 1
1: 0
2: 7
3: 61
4: 561

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200092039 Original CRISPR GACACCAGGAGGGCTGGGAG TGG Intergenic
900191507 1:1354161-1354183 GTCCCCAGGAGGGCCGGGAGGGG + Intronic
900246037 1:1636559-1636581 GCCACCAGGAGGGCTCTCAGTGG + Intronic
900257263 1:1703702-1703724 GCCACCAGGAGGGCTCTCAGTGG + Intronic
900577271 1:3389527-3389549 GCCATGAGGAGGGCTGGGATGGG - Intronic
901103529 1:6737642-6737664 GACACCAGGTGGGCGGGGAGGGG + Intergenic
901461590 1:9395126-9395148 GACTCCAGAAGTGCTGGAAGCGG + Intergenic
901682892 1:10925645-10925667 AAAACCACGGGGGCTGGGAGCGG + Intergenic
902037499 1:13468260-13468282 GACCCCAAGAGGGCTGGTGGAGG + Intergenic
902323527 1:15684165-15684187 GACTTGAGGAGGGCTGGGGGCGG + Intergenic
902368280 1:15991001-15991023 TCCACCAGGAGTGCAGGGAGGGG + Intergenic
902685384 1:18073386-18073408 TTCACCAGGAAGGCTGGGGGAGG - Intergenic
903142519 1:21347461-21347483 GGAACCTGGAGGGCGGGGAGGGG + Intergenic
903220255 1:21865373-21865395 GACACCAGCAGGATTGGAAGGGG + Intronic
903327875 1:22581616-22581638 GACCTCACGGGGGCTGGGAGAGG + Intronic
904053497 1:27655413-27655435 GACACCAGGAGCCATGGGGGGGG + Intergenic
904302279 1:29561967-29561989 GACATCAGCAGGGCAGGAAGGGG - Intergenic
904851150 1:33460776-33460798 GATCCCAAGGGGGCTGGGAGTGG + Intergenic
905170861 1:36108830-36108852 GAGACCAGGACTGCTGGGAAGGG - Intronic
905445952 1:38028642-38028664 GATCCCAGGAGGTCTGGGACAGG + Intergenic
906240996 1:44242239-44242261 GCCACCTTCAGGGCTGGGAGGGG - Intronic
906322967 1:44828027-44828049 GGCACCAGGTGGGCTTGGGGAGG + Exonic
906703459 1:47876689-47876711 GCCTCCAGCAGTGCTGGGAGGGG + Intronic
906813052 1:48849016-48849038 GGCTCCAGGTGGGCTGGGAGGGG + Intronic
907323556 1:53620664-53620686 TAAACAAGGAGGGCTGGGGGTGG + Intronic
907394125 1:54177815-54177837 AGCAGCCGGAGGGCTGGGAGTGG + Intronic
907403518 1:54240166-54240188 GAAACAGGGAGGGCTGGGTGTGG + Intronic
907550715 1:55302529-55302551 GACTCCAAAAGGGCTGGCAGAGG - Intergenic
908128044 1:61050215-61050237 GAGGGCAGGGGGGCTGGGAGAGG - Intronic
908676297 1:66607912-66607934 GTTCCCAGGAGTGCTGGGAGAGG + Intronic
908945535 1:69491775-69491797 TACACCAAGAGGGTTAGGAGGGG + Intergenic
909795182 1:79726397-79726419 TACAGCAGGAGGGCTGAGATAGG + Intergenic
909814531 1:79975343-79975365 CACAGTAGGAGGGATGGGAGAGG + Intergenic
911076512 1:93880492-93880514 AAGATCAGGAGGGCTGGGCGAGG - Intergenic
911319881 1:96400646-96400668 GAAGCCAGGAAGGGTGGGAGAGG + Intergenic
912349404 1:108997464-108997486 GAAAGAAGGAGGGCTGGGCGCGG + Intronic
912510912 1:110189655-110189677 GGCACAGGTAGGGCTGGGAGAGG - Intronic
912566848 1:110593449-110593471 GAGACCAGGCAGGATGGGAGAGG - Intergenic
915044488 1:153000515-153000537 CACACCAGGAGGCCTGGCACAGG + Intergenic
915285665 1:154850439-154850461 GACACCAGCTGGGCTAGGAGAGG + Intronic
915410146 1:155694616-155694638 GCCATCAGGCGTGCTGGGAGTGG + Intronic
915555384 1:156658072-156658094 TACACCAGGAGCACCGGGAGAGG - Intronic
916592152 1:166202763-166202785 GGAGCCAGCAGGGCTGGGAGTGG - Intergenic
916889484 1:169102632-169102654 AAGACAAAGAGGGCTGGGAGAGG - Intergenic
918066449 1:181105140-181105162 GAGGTCAGGAGGGCTGGGGGCGG + Intergenic
918180593 1:182083558-182083580 GACAGCAGGAGGGCGGTGGGTGG - Intergenic
919922113 1:202172052-202172074 GGCACCAGGAGGGCAGCCAGAGG + Intergenic
920036958 1:203072356-203072378 GTGACCAGGAGGGCAGAGAGAGG - Intronic
920546577 1:206823261-206823283 GACACCAAGATGGCTGGGTGTGG + Intronic
921972283 1:221163114-221163136 GTCAGCAGCAGGGCTGGGACTGG + Intergenic
922940753 1:229463284-229463306 GAAAGCAGGAGGTGTGGGAGGGG + Intronic
923336847 1:232978061-232978083 AACGCCTGGAAGGCTGGGAGAGG - Intronic
923514245 1:234681253-234681275 GGCACTTGGAGGGCAGGGAGGGG + Intergenic
924175586 1:241388219-241388241 GAGACCAGAAGTGATGGGAGGGG + Intergenic
924544813 1:245016484-245016506 GACACGAGGAGTGCTGGGCGTGG - Intronic
1062930203 10:1347788-1347810 GACACCAGGATTGCTGAGAAGGG + Intronic
1063128002 10:3152377-3152399 GACACCAGGAGTGCTGTCTGCGG - Intronic
1064266240 10:13827803-13827825 CACGCCAGGAGGAGTGGGAGAGG + Intronic
1065083188 10:22147499-22147521 GGAACTAGGAGGGATGGGAGGGG - Intergenic
1065794786 10:29296125-29296147 GACACCAAGAGGGAGGAGAGGGG - Intronic
1067341769 10:45411665-45411687 GGCAGCAGGTGGCCTGGGAGAGG - Intronic
1067520600 10:46999457-46999479 GACACCAGTACAGCTGGGTGTGG - Intronic
1067755147 10:48999650-48999672 CACACCAGGAAGGCGGTGAGGGG + Intergenic
1067784819 10:49237771-49237793 GACACCAGGATGGAAGGGATGGG + Intergenic
1068132829 10:52916088-52916110 CACTCCTGGAGGGGTGGGAGTGG + Intergenic
1069625196 10:69863447-69863469 GGCACCAGGAGGCATGGGTGGGG + Intronic
1069872073 10:71539292-71539314 GGGTCCAGGAGGGCTGGGACTGG - Intronic
1069873617 10:71548133-71548155 GGCAGCGGGAGGGCTGGGATTGG + Intronic
1070010821 10:72472807-72472829 AACATCAGCATGGCTGGGAGTGG + Intronic
1070711478 10:78686264-78686286 GGGGCCGGGAGGGCTGGGAGTGG - Intergenic
1070825263 10:79386996-79387018 CACACAAGCAGGGCTGCGAGTGG - Intronic
1072009373 10:91290251-91290273 AGCAGGAGGAGGGCTGGGAGAGG + Intergenic
1072670553 10:97426142-97426164 CACACCTGGAGGGCGGAGAGCGG + Exonic
1072722739 10:97790958-97790980 GCCACCAGGAGACTTGGGAGGGG + Intergenic
1073473246 10:103736844-103736866 GACACCACAAGGACTGGGAGTGG - Intronic
1074199545 10:111222697-111222719 GAAACTAGGAGGGCTTGGGGTGG - Intergenic
1074434051 10:113418651-113418673 AACACCAGGAAGACTGGGAAGGG + Intergenic
1075030575 10:119022002-119022024 GAACTCAGGACGGCTGGGAGAGG + Intergenic
1076425821 10:130366944-130366966 GCCACCAGGAAGGCTGGGGGAGG + Intergenic
1076495321 10:130893312-130893334 GACTTCAGGGGGGATGGGAGAGG + Intergenic
1076667167 10:132099981-132100003 GATCACAGGAGGGCTGGGACCGG - Intergenic
1077106599 11:844943-844965 GGGACCAGGAGGGCTGGGAGGGG + Intronic
1077152376 11:1078045-1078067 GAGGCCCGGAGGGCTTGGAGGGG + Intergenic
1077229308 11:1451454-1451476 GACACCAGGCTGGCCGGGAGAGG + Intronic
1077413767 11:2415113-2415135 GACCGCAGGAGGGCGGTGAGCGG - Exonic
1077473183 11:2774417-2774439 GAGATCAGGAGGGCTGGGATGGG - Intronic
1077508900 11:2945219-2945241 AACTGCAGGAGGGGTGGGAGAGG + Exonic
1077683664 11:4270696-4270718 GAAAGCAGGAGGGGTGGCAGGGG + Intergenic
1077686378 11:4296068-4296090 GAAAGCAGGAGGGGTGGCAGGGG - Intergenic
1077691530 11:4347256-4347278 GAAAGCAGGAGGGGTGGCAGGGG - Intergenic
1078525850 11:12100715-12100737 GAGATCAGGAGGGATGGGGGAGG + Intronic
1080502856 11:32886988-32887010 GAAACCAGGAGGTCTGGGAAAGG - Intergenic
1081729218 11:45357165-45357187 GACATAAGGAGCCCTGGGAGAGG - Intergenic
1081910284 11:46695882-46695904 GACGCCAGGAGGGCAGGATGGGG - Intronic
1081995785 11:47363105-47363127 GGCACCATGAGGGCAGGGACTGG + Intronic
1082788454 11:57330633-57330655 GCCCCCAGTGGGGCTGGGAGAGG - Intronic
1083156748 11:60828069-60828091 GACAACAAGAGGGCTGTGTGGGG + Intergenic
1083300471 11:61737424-61737446 GTCACATGGAGGTCTGGGAGTGG + Intronic
1084272977 11:68038920-68038942 GAGTCCAGGAAGTCTGGGAGAGG - Intergenic
1084517417 11:69644346-69644368 GACACAAGAAGGGCTGGAGGTGG - Intronic
1084582036 11:70030041-70030063 GCCACCAGGAGGGGTGGGGAGGG + Intergenic
1084785174 11:71437968-71437990 GGCCCCAGGAGGGCCGGGGGTGG - Intronic
1084968494 11:72756648-72756670 GACACCAGGAGACCTGGGACAGG + Intronic
1085296215 11:75433214-75433236 GACGCCAGGAGGGAGGGGAAGGG + Intergenic
1085514031 11:77102096-77102118 TAAACCAGGAGTTCTGGGAGGGG + Intronic
1085584228 11:77686127-77686149 AACAGCAGGATGGCTGGGTGTGG + Intronic
1085763198 11:79260006-79260028 GCCACCTGGAGGGCTGTGGGTGG + Intronic
1086773172 11:90794867-90794889 GACAACAGGAGGGCTGAGCCAGG + Intergenic
1087012245 11:93525103-93525125 GGCAGCAGGAGCCCTGGGAGAGG - Intronic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1089146582 11:116333555-116333577 GAAGTCAGGAGTGCTGGGAGCGG - Intergenic
1089617965 11:119705867-119705889 CTCACCTGGAGGGGTGGGAGAGG - Intronic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1089779152 11:120860947-120860969 GATACAAGGGGGCCTGGGAGAGG - Intronic
1091045045 11:132317885-132317907 TCCCCCAGGAGGGCTGGGAAGGG + Intronic
1091123597 11:133077190-133077212 GATATCAGGAGGGCTGGGTTTGG + Intronic
1091398235 12:167316-167338 GGCACCAGCATTGCTGGGAGAGG + Intronic
1091704026 12:2681626-2681648 AGCTCCAGGAGGACTGGGAGGGG - Intronic
1091737452 12:2934583-2934605 GACACCAGGAGGGCAGGCAGCGG - Intronic
1091803761 12:3341872-3341894 GTCAGGAGGAGGGCTGGAAGTGG - Intergenic
1091875878 12:3932361-3932383 GACACCATCAGGGCAGGGAGAGG - Intergenic
1092025895 12:5240187-5240209 GGCACCAGCAGGCCTGAGAGTGG + Intergenic
1092219823 12:6705357-6705379 GACAGGAGGAGGGCCGGGCGCGG - Intergenic
1092977588 12:13760229-13760251 AGCACCAGGAGGGCAGGGATCGG + Intronic
1093938969 12:25031950-25031972 CACACAAGGACGGCTGGGCGTGG - Intronic
1094023754 12:25941409-25941431 GACAACAGGATGGGTGGGTGTGG - Intergenic
1094480423 12:30876907-30876929 GACACAAGGTGGGTAGGGAGGGG + Intergenic
1094484665 12:30915025-30915047 GAACCCAGGAGGGTGGGGAGAGG - Intergenic
1094489060 12:30947253-30947275 GCCAGGAGGAGGGCTGGAAGTGG + Intronic
1096612250 12:52810100-52810122 GAAAAAGGGAGGGCTGGGAGGGG + Intronic
1096657984 12:53103610-53103632 GAGGACAGAAGGGCTGGGAGGGG + Exonic
1097250322 12:57628931-57628953 CAGACAAGGAGGGTTGGGAGAGG + Intronic
1097820254 12:64121296-64121318 GACACAAGGAAGGCGGGGCGTGG - Intronic
1098731496 12:74040951-74040973 GGCACCACCATGGCTGGGAGAGG - Intergenic
1099895387 12:88639719-88639741 GACTTCTGGAGGGCTGGCAGAGG + Intergenic
1100390956 12:94146517-94146539 CATTCCAGGAGGGCAGGGAGTGG + Intergenic
1100858045 12:98775745-98775767 GAGAACAGGAGGGCTGGGCCAGG - Intronic
1101624335 12:106424142-106424164 GACACCATGAGGGCTGGGCTCGG - Intronic
1103828959 12:123763259-123763281 GACACTGAGAGGGCAGGGAGGGG + Intronic
1103900079 12:124298991-124299013 GACCACCGGAGGGCCGGGAGAGG + Intronic
1103940508 12:124498965-124498987 GCTACCAGGAGGGCAGGGTGAGG + Intronic
1103949417 12:124542950-124542972 GATTCCAGGAGGGCTGGCACGGG - Intronic
1103976829 12:124708064-124708086 GAAAGGAGGAGGGCTGGGAGTGG - Intergenic
1104576029 12:129966542-129966564 GAAGGCAGGAAGGCTGGGAGAGG + Intergenic
1104623496 12:130335947-130335969 GATTCCAGGAGGTCTGGGACGGG - Intergenic
1104762230 12:131304368-131304390 GCCACAAGGAGGGCTGGGGAAGG + Intergenic
1104817546 12:131656428-131656450 GCCACAAGGAGGGCTGGGGAAGG - Intergenic
1104855880 12:131902321-131902343 GACAAGAGTAGGGCTGGCAGAGG + Intronic
1104901438 12:132191378-132191400 GACACAAGGAGGGCTTCTAGAGG - Intergenic
1105039606 12:132952655-132952677 GTCATCAGGAGGGATGGAAGAGG + Intronic
1105389177 13:19959119-19959141 GAGGCCGGGAGGGCTGGGTGAGG + Intronic
1106519779 13:30486522-30486544 GTATCCAGGAAGGCTGGGAGTGG + Intronic
1106859074 13:33885490-33885512 GAAACCTAGATGGCTGGGAGGGG - Intronic
1108447850 13:50527230-50527252 CAGAACAGGAGGGCGGGGAGGGG - Intronic
1111768260 13:92562353-92562375 GGCACCAGAAGGACTGAGAGTGG - Intronic
1111920335 13:94403154-94403176 GAGACCAGGAGAGCAGGGAGTGG - Exonic
1112374986 13:98830752-98830774 CACTCCATGAGGGCTGGGAGAGG + Intronic
1112498604 13:99925150-99925172 GGCACCTGGAGGGCTGTGGGTGG - Intergenic
1113158142 13:107349223-107349245 GACACCAGGTGGGGAAGGAGGGG - Intronic
1113786131 13:113003062-113003084 GCCACCTGGGGGGCTGAGAGGGG + Intronic
1113871486 13:113562492-113562514 GGCACCAGGACTGCCGGGAGGGG - Intergenic
1114262947 14:21051908-21051930 TACCCCAGGAGGGCTGAGCGAGG - Intronic
1117030173 14:51660751-51660773 GACAGTAGGAGTGCTGGGGGAGG + Intronic
1117211608 14:53506718-53506740 GACAGGAGGAGGGGAGGGAGAGG - Intergenic
1117438536 14:55740286-55740308 GGCAGCAGGAGAGGTGGGAGAGG + Intergenic
1117732622 14:58738986-58739008 GAGGCCAGGAGGAATGGGAGAGG + Intergenic
1117732627 14:58739070-58739092 GACATCTGGAGGGCAGGGAGTGG - Intergenic
1118315169 14:64721703-64721725 ATCTCCAGGAGGGATGGGAGGGG + Intronic
1118335052 14:64846280-64846302 AACATCAGGAGGGGTAGGAGGGG + Intronic
1119383479 14:74242788-74242810 GGTGCCAGGAGGGGTGGGAGGGG + Intronic
1119420546 14:74505563-74505585 GAGACGAGGAAGGGTGGGAGGGG - Intronic
1119615415 14:76095797-76095819 GACAGTAGGAGGGTGGGGAGGGG - Intergenic
1120944661 14:89982748-89982770 CACACCAGGATGGCTGCCAGAGG - Intronic
1121534743 14:94683849-94683871 AACACCAGGAGGGAGGAGAGGGG - Intergenic
1121735289 14:96213982-96214004 GAGACCAGTGGGGCAGGGAGGGG + Intronic
1121898869 14:97674058-97674080 GAAACCAGGAAGGCTCAGAGGGG + Intergenic
1122082507 14:99275068-99275090 GACAGCAGGCGGGGCGGGAGGGG + Intergenic
1122367488 14:101202790-101202812 GAGACCACAAGGGCAGGGAGAGG + Intergenic
1122473436 14:101988236-101988258 GACACCTGGAGGGCTAGAAAAGG - Intronic
1122518545 14:102326237-102326259 ACCACCTGGAGGGCTGGCAGTGG - Exonic
1122601844 14:102925454-102925476 AACAGGAGGAGGGCAGGGAGAGG + Intronic
1122647639 14:103205988-103206010 GACTCCAGGGGGACAGGGAGGGG + Intergenic
1123578899 15:21698518-21698540 GACACCAGGAGGCATGAGAAGGG + Intergenic
1123615526 15:22141000-22141022 GACACCAGGAGGCATGAGAAGGG + Intergenic
1123804889 15:23860648-23860670 GAAAGCTCGAGGGCTGGGAGGGG + Intergenic
1124014712 15:25864828-25864850 GTCACCAGGTGGGCTGGTAGAGG - Intronic
1124237663 15:28003955-28003977 GACACCAGCAGAGCCGGGAAGGG - Intronic
1124512416 15:30338526-30338548 AACAGCAGGAGAGCTGGGAAGGG + Intergenic
1124711471 15:32016166-32016188 GGCACCAGGAGGCCTGGGGTTGG + Intergenic
1124730498 15:32192225-32192247 AACAGCAGGAGAGCTGGGAAGGG - Intergenic
1125522738 15:40357307-40357329 GAAGCCTGGGGGGCTGGGAGTGG - Intergenic
1126114105 15:45193357-45193379 GACAACTGGAGGCCAGGGAGGGG + Intronic
1127649027 15:60988211-60988233 GCCAGAAGGAGGGTTGGGAGAGG + Intronic
1128030499 15:64475679-64475701 GACAACATGCGGGCTGGGCGCGG - Intronic
1128224415 15:65992048-65992070 GAGACAAGGAGGCCCGGGAGCGG + Intronic
1128349490 15:66879653-66879675 GACACAGTGAGGGGTGGGAGTGG + Intergenic
1129760431 15:78126087-78126109 CAGCCCAGGAGGGCTGGGAATGG + Intronic
1129848210 15:78777661-78777683 GACAGGAGGAGAGGTGGGAGGGG + Intronic
1129882532 15:79016752-79016774 GCCAGAAGGAAGGCTGGGAGCGG + Intronic
1130645952 15:85727270-85727292 GACATCAGGAGGGCTGGGAAGGG - Intronic
1130955488 15:88624311-88624333 AAGAGCAGGAGGGCTGTGAGTGG + Intronic
1131060853 15:89403778-89403800 GAAACCAAGAGGACTGGGAAGGG + Intergenic
1131096268 15:89655908-89655930 GGCACCAGGAGGGGCAGGAGAGG + Intergenic
1202987769 15_KI270727v1_random:432763-432785 GACACCAGGAGGCATGAGAAGGG + Intergenic
1132696950 16:1206302-1206324 GACACTGGGCGGGCCGGGAGGGG - Intronic
1132845706 16:1999936-1999958 CCCACCAGGAAGGCTGGGAAGGG - Exonic
1132883201 16:2171369-2171391 GGCAGCAGGGGGGCTGGGAAGGG - Intronic
1132982546 16:2745841-2745863 GGCACCTGGAGGGATGGGCGTGG + Intergenic
1133115173 16:3574422-3574444 GACCCGAGCGGGGCTGGGAGAGG + Intronic
1133240771 16:4413052-4413074 ATGGCCAGGAGGGCTGGGAGGGG - Intronic
1133533366 16:6675981-6676003 GACACCAAGGGCGATGGGAGAGG + Intronic
1133606934 16:7396647-7396669 CACAGCAGGTGGGCTGAGAGTGG + Intronic
1134052433 16:11146185-11146207 GACCCCTGGAGTGCTGGGAGTGG - Intronic
1134402306 16:13920878-13920900 AACACTAAGAGGGATGGGAGGGG + Intronic
1134776001 16:16854197-16854219 GGCACCAGGAATACTGGGAGAGG + Intergenic
1135400272 16:22162314-22162336 GAAGCCAGTAGGGCTGGGATGGG - Intergenic
1135414757 16:22260563-22260585 GACCCCAGCAGGGGTAGGAGTGG + Intronic
1135888824 16:26338778-26338800 GACACCAGAGGGGAGGGGAGAGG - Intergenic
1136108620 16:28050419-28050441 GCCTCCAGAAGGGCTGGGATTGG + Intronic
1136383289 16:29907017-29907039 GCCTCCAGGAGGGCTGGGTCTGG + Exonic
1137573197 16:49579811-49579833 GGCACAGGGAGGGCTGGCAGAGG + Intronic
1137609587 16:49809808-49809830 GACACCAGGGGGTCTGGGGCTGG + Intronic
1137613628 16:49834880-49834902 GGGCCCAGGAGGGCTGGGGGAGG + Intronic
1137757991 16:50917973-50917995 GACACCAGCCAGGCTGGGAAGGG - Intergenic
1138555203 16:57766849-57766871 GACTGCAGGAGGGCTGGGGGTGG - Intronic
1138931208 16:61659319-61659341 GAGACAAGGAAGGATGGGAGTGG - Intronic
1139351925 16:66342427-66342449 GACACCTGGATGGGTGGGACAGG + Intergenic
1139364502 16:66425674-66425696 GCCTGCAGGAGGGCGGGGAGTGG + Intergenic
1139965796 16:70744664-70744686 GCCACCTGCAGGGGTGGGAGGGG + Intronic
1140914706 16:79483182-79483204 GACAGAAGGAGGGAGGGGAGGGG - Intergenic
1140969514 16:79999404-79999426 GAGGCCAGGAAAGCTGGGAGTGG - Intergenic
1141181074 16:81753840-81753862 AGCAGCTGGAGGGCTGGGAGAGG + Intronic
1141476078 16:84274377-84274399 GAAGCCAGGAGGGCTGGCAGGGG - Intergenic
1141639502 16:85333181-85333203 CATACCAGGAGGGGTGGCAGGGG + Intergenic
1141661054 16:85441760-85441782 GACACCAGGATTGATGGCAGTGG + Intergenic
1141689399 16:85587844-85587866 GACACGGGAAGGGCTGGGGGAGG - Intergenic
1141693740 16:85610614-85610636 GCCACCAGGCGGGCTGGCAAGGG - Intergenic
1141697666 16:85627860-85627882 GACACAGGGATGGCGGGGAGAGG - Intronic
1141808068 16:86355080-86355102 GCAACCAGGATGGTTGGGAGTGG + Intergenic
1142177303 16:88651096-88651118 GTCACCTGGGGGGCTGGGGGCGG - Exonic
1142338631 16:89506844-89506866 GACACCAGGTGGGCCGGGCGCGG - Intronic
1142354632 16:89596744-89596766 GATCCCAGGAGGACTGGGAGTGG - Exonic
1142674772 17:1506965-1506987 GACACCAGGTGAGGAGGGAGTGG - Exonic
1143348072 17:6265044-6265066 GGGACCAGGACGGCTGGGAGTGG + Intergenic
1143498821 17:7327234-7327256 GGGACCAGGTGGGATGGGAGGGG + Intronic
1143639931 17:8190013-8190035 GACACCCGGAGGCCTGCGGGCGG + Exonic
1143711980 17:8741705-8741727 GGCCCCGGGAGGGCTGGGCGAGG - Intronic
1144490446 17:15704330-15704352 GGCCCCAGGGGGCCTGGGAGGGG - Intronic
1145278765 17:21453629-21453651 GTCACCATGTGGGCTGGGAGGGG - Intergenic
1145399088 17:22516857-22516879 GTCATCATGTGGGCTGGGAGAGG + Intergenic
1145399176 17:22517345-22517367 GGCCTCCGGAGGGCTGGGAGGGG - Intergenic
1147044366 17:37742660-37742682 GGCCCCAGCAGGGCAGGGAGAGG - Intronic
1147591774 17:41688676-41688698 GACTCTAGGAGAGCTGGGAGGGG - Intergenic
1147921640 17:43920829-43920851 GACATCAAGAGGGCGTGGAGGGG + Intergenic
1148232914 17:45948293-45948315 GAGCCCAGGAGGGCTGGGTGCGG - Intronic
1148243045 17:46012659-46012681 GATACCTGGAGGGCAGGGAGGGG - Intronic
1148342847 17:46883875-46883897 GACTTGAGGAGGGATGGGAGTGG - Intronic
1148351897 17:46947173-46947195 GAAACCAGGAGGGCTGGGGAAGG + Intronic
1149196973 17:54132896-54132918 GACAGCAGGCTGGCTGGGGGAGG - Intergenic
1149557590 17:57585109-57585131 GACCCTAAGAGGGCTGGGCGTGG - Intronic
1149602844 17:57904361-57904383 GCCACCAGGAGTGGTGGGAAAGG + Intronic
1150315050 17:64162001-64162023 GACACCATTAGTGCTGGGTGGGG - Intronic
1150616697 17:66777898-66777920 GATCCCAGGAAGGCTTGGAGAGG - Intronic
1151353122 17:73543209-73543231 GACTCCAGAAGGGCTGGGGAGGG + Intronic
1151457075 17:74232645-74232667 GGCAGCAGGATGGCAGGGAGGGG - Intronic
1151473591 17:74332651-74332673 TAGGCCAGGAGGGCTGGGTGAGG + Intronic
1151696928 17:75722498-75722520 GACAGCAGGAGGGACAGGAGGGG + Intronic
1151836642 17:76586352-76586374 GACGCCAGGACAGCTGGGAGGGG + Intronic
1152290864 17:79439273-79439295 GGCATCAGGAGGGCTGGGGAGGG - Intronic
1152612743 17:81323553-81323575 GGCCCCAGGAGGGGTGGGGGCGG + Intronic
1153354032 18:4115752-4115774 GACACCAGATGGGCTGGGCGCGG - Intronic
1153968305 18:10201859-10201881 GTCAGCATGAGGGCTGGGATGGG + Intergenic
1154079050 18:11236137-11236159 GACTCCAGGAGGGATGGGAATGG - Intergenic
1154122154 18:11660758-11660780 GAAACCAGGAGGGAGGGAAGGGG + Intergenic
1155877989 18:31110943-31110965 GACACAATGAGGGCTGGGCTGGG - Intergenic
1156235898 18:35204511-35204533 GACACCACGCTGGCTGGGACAGG - Intergenic
1156413151 18:36856013-36856035 GAAACCATGAAGGCTGGAAGTGG - Intronic
1157168818 18:45383640-45383662 AACACCTGGAGGCCTGTGAGGGG - Intronic
1157221219 18:45829577-45829599 GACACCTGGAGGGCCAGGAGAGG - Intronic
1157310898 18:46552502-46552524 GAGGCTAGGAGGGCTAGGAGTGG + Intronic
1157496550 18:48161270-48161292 TTCTCCAGGAGGGCTGGGAGTGG + Intronic
1157824415 18:50799981-50800003 ACCACCAGGAGGGCAGGGACCGG + Intronic
1158994403 18:62902716-62902738 GACACCACTACAGCTGGGAGAGG - Intronic
1160386102 18:78497878-78497900 GAGCTCAGGAGGGCTGGAAGCGG + Intergenic
1160772051 19:836697-836719 GGCGACAGGAGCGCTGGGAGCGG - Intergenic
1160917327 19:1503509-1503531 GTCACGAGGAGGCCTGCGAGAGG + Intergenic
1160949235 19:1657791-1657813 GACAGAAGGAGGGCTCGGGGAGG - Intergenic
1160970381 19:1765282-1765304 GACGCCAGCAGTGCTGGGGGCGG - Intronic
1161364119 19:3868604-3868626 GCCACGAGGAGGGCAGCGAGAGG - Intronic
1161510019 19:4665068-4665090 GCCACCAGGAGGGCGGGGCAGGG - Intronic
1161747233 19:6068498-6068520 GACAGAAGGAGTGCTGGGATAGG + Intronic
1161835241 19:6641545-6641567 GACACAGGGAGGGCAGGGCGTGG - Intergenic
1161945340 19:7432629-7432651 GAAACAAACAGGGCTGGGAGTGG - Intronic
1162032354 19:7922976-7922998 GACATCAGGAGGCTTGTGAGTGG - Exonic
1162394633 19:10409820-10409842 AACACAAGCAGGGCTGGGAGCGG + Intronic
1163223265 19:15937010-15937032 GATACAAGGAGGGCCAGGAGGGG - Intergenic
1163338626 19:16689798-16689820 GTCACCAGGATGTCTGAGAGGGG + Exonic
1163632624 19:18425083-18425105 GACAGCAGGAGGGGGCGGAGAGG + Intronic
1163656128 19:18546117-18546139 ATCACCTGGAGGGCTGGGTGCGG + Intergenic
1164428789 19:28168763-28168785 GACAGCAGGAGGTCTGGAGGAGG - Intergenic
1164581621 19:29438678-29438700 GAGACAGGGAGGGATGGGAGGGG + Intergenic
1165092619 19:33394888-33394910 GACTCCAGGAGGGGTGGGGCAGG - Intronic
1165496308 19:36153956-36153978 GCCACAAGTAGGGCTGGGCGTGG + Intergenic
1165541942 19:36499080-36499102 GCCTCCAGGTGGGGTGGGAGGGG - Intergenic
1165935440 19:39385826-39385848 GACATCATAGGGGCTGGGAGGGG + Intergenic
1165956169 19:39503339-39503361 GGCAACAAGAGGGCTGGGAGAGG - Intronic
1166060803 19:40324160-40324182 GACACCAGTAGCTCTGGGACAGG + Intronic
1166214192 19:41325140-41325162 GACCCCGGGAGAACTGGGAGGGG - Intronic
1166382959 19:42364563-42364585 GAGACCAGGAGGGCAGGGTGTGG + Intronic
1166666080 19:44681253-44681275 GACACCAGGAGGACTGGAGAGGG - Exonic
1166673604 19:44725892-44725914 GACACCAGGTGGCCTGGGTTAGG - Intergenic
1166683736 19:44782647-44782669 GAGAAGAGGCGGGCTGGGAGGGG - Intronic
1166834828 19:45660932-45660954 GACCCCAGGAGGGCTGAGGTGGG + Intergenic
1166871932 19:45876560-45876582 GAAACCCAGAGAGCTGGGAGAGG - Intergenic
1167244269 19:48364379-48364401 GGGACCAGGAGGGGTGGGGGTGG + Exonic
1167246049 19:48373795-48373817 GGAGCCAGGAGGGCTGTGAGCGG - Intronic
1167689902 19:50978887-50978909 GAGAGCAGGGGGGCAGGGAGAGG + Intronic
1168292598 19:55363836-55363858 GACTCCAGGCTGGCTGGGCGCGG - Intergenic
1168300541 19:55402367-55402389 GACACCAGGACTGCTGGCTGAGG + Intronic
1168316204 19:55485793-55485815 GGCCCCAGGGGGCCTGGGAGTGG + Intronic
1168410268 19:56135537-56135559 GGTACCATGAGGGCTGGTAGTGG - Intronic
1168714181 19:58517682-58517704 AACAAGAGGAGGGCAGGGAGAGG + Intronic
925047212 2:781803-781825 GACACAGGGACGGCTTGGAGGGG - Intergenic
925170729 2:1748820-1748842 GACACCTGGATGGCTTGGAAAGG - Intergenic
925262312 2:2539517-2539539 GTTCCCAGGAGAGCTGGGAGGGG - Intergenic
925422379 2:3723499-3723521 GAGAGCAGGGAGGCTGGGAGGGG + Intronic
925563754 2:5227045-5227067 GATCTCAGCAGGGCTGGGAGCGG - Intergenic
926251818 2:11159245-11159267 GAGCCCAGGGGGGCTGGCAGAGG - Intronic
926633495 2:15158227-15158249 GACAGCAGGAGAGCTGGCTGTGG + Intergenic
926890772 2:17637321-17637343 TACACCAGGAGGGGTGGAGGAGG + Intronic
927114320 2:19886216-19886238 GACACCAGGGAGGCTGGGCTGGG + Intergenic
927435301 2:23061285-23061307 GAAACAAGGGGGGCTGGGCGCGG - Intergenic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
927708416 2:25311068-25311090 GACTCCAGGAAGTATGGGAGTGG + Intronic
927904812 2:26848617-26848639 GACCGCTGGAGGGCTGGGCGGGG + Intronic
928182743 2:29080920-29080942 GAGGCCAGGAGGGCTGAGGGAGG - Intergenic
928280011 2:29937717-29937739 GATATCAGGAGGGGTGGGATGGG + Intergenic
928393453 2:30926735-30926757 GACACCAGAGGGGCCGGGGGTGG + Intronic
929007808 2:37412440-37412462 GACACCAGCTGGGCTGTGTGAGG + Intergenic
929120034 2:38476823-38476845 GACTTGAGGAGGGCTGGGAGGGG + Intergenic
930016089 2:46971481-46971503 GATACCAGGAGGGCCTGGTGTGG + Intronic
930035874 2:47084673-47084695 GAGACCATGAGGCCTGAGAGAGG + Intronic
930035904 2:47084885-47084907 GAGACCATGAGGCCTGAGAGAGG + Intronic
930035911 2:47084915-47084937 GAGACCATGAGGCCTGAGAGAGG + Intronic
931896531 2:66737060-66737082 GACACCAGGAAGACTGTGACAGG - Intergenic
932088048 2:68779816-68779838 GACACCAGTAGGGGTGAGGGTGG - Intronic
932218732 2:69983974-69983996 GACCTCAGGAAGGCTGGGAAAGG - Intergenic
932757217 2:74417228-74417250 AGGAGCAGGAGGGCTGGGAGTGG + Intronic
933712643 2:85338614-85338636 GAAACCAAGAGGGTTGGCAGTGG + Intergenic
933988998 2:87620032-87620054 CCCACCAGGAGAGGTGGGAGGGG + Intergenic
934073792 2:88409999-88410021 GGCTCCAGGAAGGCTGGGCGCGG + Intergenic
934917266 2:98310310-98310332 GACCCCAGGAGGGCATGGAGTGG + Intronic
935558639 2:104538181-104538203 GAAGCCAGGAGGGGTGGAAGTGG + Intergenic
935786310 2:106551938-106551960 GAAACCAGGAAGGATGTGAGAGG - Intergenic
935850172 2:107210612-107210634 GACAGCATGAGGGCCGGGCGCGG + Intergenic
936144638 2:109972096-109972118 GACTCTAGTAGGGCTGTGAGAGG + Intergenic
936181322 2:110270059-110270081 GACTCTAGTAGGGCTGTGAGAGG + Intergenic
936200049 2:110399373-110399395 GACTCTAGTAGGGCTGTGAGAGG - Intergenic
936304845 2:111330794-111330816 CCCACCAGGAGAGGTGGGAGGGG - Intergenic
937915906 2:127098584-127098606 GACAGCAGGTGGGGTGGGATTGG - Intronic
940515699 2:154681622-154681644 GACAGCAAGAGGGAAGGGAGGGG - Intergenic
940584373 2:155626493-155626515 GACCCCAGCAAAGCTGGGAGTGG + Intergenic
941588078 2:167384584-167384606 GACAGCATGAGGGAAGGGAGAGG - Intergenic
941628420 2:167856640-167856662 GACACCAGGAAAGCTTGGACTGG + Intergenic
943017397 2:182529581-182529603 GAGACCACGAGGTTTGGGAGGGG + Intergenic
943262974 2:185689221-185689243 GCCAACAGGAGAGCTTGGAGGGG + Intergenic
943479781 2:188404403-188404425 CACACCAAGAGGGCTGGGGTTGG - Intronic
944193101 2:197024279-197024301 GACACCAGGAAGAATGGGAAGGG - Intronic
945797767 2:214386082-214386104 GACAAAAGTAGGGCTGGGTGCGG + Intronic
946409649 2:219509654-219509676 GAGAGCAGGAGGGCAGGGGGTGG + Intergenic
946843218 2:223837684-223837706 GAGAGCAGGAGGGCGAGGAGCGG - Intronic
947679526 2:232017387-232017409 AACACCAATAGGGCTGGGTGTGG - Intronic
947706736 2:232282336-232282358 GGCACCAGCAGGGGTGGGATGGG - Intronic
947724282 2:232387686-232387708 GGGACCAGGAGGGCTCGGCGGGG + Intergenic
1169424768 20:5487223-5487245 GACACAAAGAGGGCAGGGAAGGG - Intergenic
1172189190 20:33051592-33051614 GACACAAAGAGGGCTTTGAGAGG + Intergenic
1172992595 20:39047607-39047629 GGCACCAGGGAGGCTGGGATGGG - Intergenic
1173191973 20:40883620-40883642 GACACCTGGAGTGCAGTGAGGGG + Intergenic
1173229151 20:41180691-41180713 CACACCAGGAGGGGTGGGGCAGG - Exonic
1174283290 20:49454633-49454655 GAAGGCAGGAGGGCTGGGCGCGG + Intronic
1175124723 20:56742746-56742768 GACACCAGAGGGTCTGTGAGGGG + Intergenic
1175723342 20:61300678-61300700 GGCAGCAGGAAGGCTGGGTGTGG - Intronic
1175990553 20:62786408-62786430 GACTCCAGGAGCCCTGGGGGTGG - Intergenic
1177758276 21:25373615-25373637 GAGAGGAGGAGGGGTGGGAGAGG - Intergenic
1178268984 21:31172178-31172200 GACACCAGCATGGCAGGAAGAGG + Intronic
1178505906 21:33162835-33162857 GACAAGAGGAGGGCTGGGAGTGG - Intergenic
1178687479 21:34722994-34723016 GACACCCAGAGGGCTGGGCTAGG - Intergenic
1178719775 21:34998203-34998225 GAAGCAAGAAGGGCTGGGAGAGG + Intronic
1178875993 21:36414247-36414269 GTCACGAGGAGAGCTGGGAAGGG + Intronic
1179183780 21:39067621-39067643 GACACCAAGAGGACTTGGCGAGG + Intergenic
1179256899 21:39724774-39724796 GCCACCAGCTGGGCAGGGAGAGG + Intergenic
1179893934 21:44351066-44351088 GGCACCAGCAGGACTGGGACAGG - Intronic
1180052230 21:45336369-45336391 GGCACCTGGAGGGGTAGGAGGGG + Intergenic
1180061590 21:45388144-45388166 GAGAGCAGGAGGGGCGGGAGTGG - Intergenic
1180067716 21:45420934-45420956 GACACAGGCAGGACTGGGAGAGG - Intronic
1180829633 22:18897222-18897244 GACACTAGGACTGCTAGGAGGGG - Intergenic
1180839849 22:18954207-18954229 GACACCCTAAGGGCTGGGAATGG + Intergenic
1180967875 22:19799959-19799981 GCCAGGAGGAGGCCTGGGAGGGG - Intronic
1180972572 22:19823020-19823042 GAGGGCAGGAGGCCTGGGAGGGG + Intronic
1181062046 22:20286272-20286294 GACACCCTAAGGGCTGGGAATGG - Intergenic
1181277595 22:21696373-21696395 TTCAGCAGGAGGGCGGGGAGAGG - Intronic
1181313503 22:21957944-21957966 GGCAGCAGGAGGGCAGGGATGGG + Intronic
1181346610 22:22224016-22224038 GGCAGCAGGAGGGCAGGGATGGG + Intergenic
1181514836 22:23404595-23404617 TGCTCCAGGAGGGGTGGGAGGGG - Intergenic
1182713738 22:32338929-32338951 GCCCCCAGGAGAGCTGGGATTGG + Intergenic
1183095322 22:35548579-35548601 GGCGGCAGCAGGGCTGGGAGTGG - Intronic
1183096602 22:35555713-35555735 GAGACCATCAGGGCTGCGAGAGG - Intergenic
1183180663 22:36257733-36257755 GAGGAGAGGAGGGCTGGGAGAGG + Intronic
1183486224 22:38089054-38089076 GGCGGCAGGAGGGCCGGGAGAGG - Intronic
1183687110 22:39367471-39367493 GACCCCAGGAGCGGTGGGCGGGG + Intronic
1183950997 22:41353178-41353200 AAGATCAGGAGGGATGGGAGGGG - Intronic
1184099684 22:42335618-42335640 GACAGCAGGGGGGCAGAGAGTGG + Intronic
1184254767 22:43280654-43280676 GACAGAAGGAGGGCTGATAGGGG - Intronic
1184401025 22:44274510-44274532 GCCCCCAGGAGAGCTGGGATTGG + Intronic
1184455504 22:44607571-44607593 GCCAAGAGGAGGCCTGGGAGGGG + Intergenic
1184560153 22:45258082-45258104 GACAGCAAGAGGGGTGGGAGGGG - Intergenic
1203279724 22_KI270734v1_random:122494-122516 GACACTAGGACTGCTAGGAGGGG - Intergenic
949864360 3:8535157-8535179 GAGAACAGCAGGGCTGGAAGTGG - Intronic
950034946 3:9878644-9878666 GACAGGAGAAGGGCTGGGGGAGG - Intronic
950453614 3:13079503-13079525 GACTCAAGCAGGGCTGTGAGAGG + Intergenic
950575472 3:13829709-13829731 GAGACAAGGAGGGCAGGGGGAGG + Intronic
950794934 3:15503120-15503142 GACAGCAGGAAGGTTGGAAGTGG - Intronic
950967124 3:17154307-17154329 GTAACCTGGAGGGCAGGGAGAGG + Intergenic
951897276 3:27622131-27622153 GACACCAGGAGGGTTTAGAGAGG - Intergenic
952711034 3:36432293-36432315 GAGACCAGCAGAGCTGGGAAGGG + Intronic
952937762 3:38413529-38413551 GAAACAAGGAGGGCAGGGTGTGG - Exonic
953337285 3:42104101-42104123 GGCAGCAGGGAGGCTGGGAGAGG + Intronic
953962023 3:47273717-47273739 GGCACCAGGCATGCTGGGAGAGG - Intronic
954761965 3:52881411-52881433 GAACTCAGGAGGGCTGGGCGCGG + Intronic
954807534 3:53229213-53229235 TGCACCAGGAGGTATGGGAGGGG - Intronic
955494341 3:59515980-59516002 GATGCTGGGAGGGCTGGGAGTGG - Intergenic
956072299 3:65466523-65466545 GATACCAGCTAGGCTGGGAGGGG + Intronic
956717682 3:72092726-72092748 GGCATCAGGAGGTCTGGGAAGGG - Intergenic
957253481 3:77805744-77805766 GACACAAGGTGGGGTGGGATAGG + Intergenic
958839189 3:99182953-99182975 AACATCAGGAGGGCTGGGGGCGG - Intergenic
958922223 3:100120470-100120492 GACAGAAGGAAGGCTGAGAGGGG - Intronic
959921418 3:111872413-111872435 GACAACAGGAGGGAGGGAAGTGG - Intronic
960174978 3:114506454-114506476 GAAAGCAGTAGTGCTGGGAGGGG + Intronic
961128128 3:124440064-124440086 GATAGGAGGAGGGCAGGGAGAGG - Intronic
961622726 3:128237606-128237628 AACACCCGCAGAGCTGGGAGAGG - Intronic
961741680 3:129036918-129036940 GCCACCTGGAAGGCTGGGAGAGG + Intronic
964756555 3:160094719-160094741 AAGGCCAGTAGGGCTGGGAGAGG - Intergenic
964943037 3:162185076-162185098 GAGACTAGGTGGGATGGGAGTGG - Intergenic
965496465 3:169404648-169404670 GACTCCAGGAAGCCTGGCAGTGG - Intronic
966063452 3:175787300-175787322 GGCAGCAGGAAGGCTGGGGGAGG - Intronic
966714903 3:183005240-183005262 GACCACTGGAGGGCTGGGAGGGG - Intergenic
966886908 3:184381866-184381888 GAAACTGGGAGAGCTGGGAGGGG + Intronic
966914667 3:184578153-184578175 GACACAGGCAGGGATGGGAGAGG - Intronic
967272287 3:187741548-187741570 GACATCGGGAGGGTTGGGAGGGG + Intronic
967718390 3:192789308-192789330 GAGCCCAGGAGGGTTGGGGGAGG - Intergenic
968344025 3:197984966-197984988 GGCAGCAGAAGGGCTGGGCGCGG - Intronic
968519649 4:1029700-1029722 GAAGCCAGGAGGGCCGGGCGGGG - Intergenic
968614222 4:1570136-1570158 GACACCTGTGGGGCTGTGAGGGG + Intergenic
968897975 4:3415918-3415940 GGCAGCAGGAGTGCGGGGAGAGG + Intronic
968943373 4:3651051-3651073 GACCCCAGGAGCTCTGGAAGTGG + Intergenic
969059331 4:4422657-4422679 GGCTCCAGGGGGCCTGGGAGGGG - Intronic
969172432 4:5375087-5375109 GAGACCACCAGGGGTGGGAGGGG - Intronic
969445329 4:7241573-7241595 CACCCCAGAAGGGCAGGGAGGGG - Intronic
970442398 4:16093110-16093132 GACACCAGGTAGGGTGGCAGGGG + Intergenic
971344380 4:25798535-25798557 AAGACCAGGACGGCTGGGCGAGG + Intronic
972511325 4:39770749-39770771 GCCCCCTGGAGGCCTGGGAGGGG - Intronic
973177124 4:47220821-47220843 GCCACAAGAGGGGCTGGGAGAGG - Intronic
973917352 4:55649194-55649216 GGCAGCAGGGGGGCTGGGGGCGG - Intergenic
974614637 4:64265901-64265923 GACACCATGAGATTTGGGAGGGG - Intergenic
974665188 4:64952362-64952384 GGCCCCAGGAGACCTGGGAGAGG + Intergenic
975746458 4:77480196-77480218 TACACCATCAGGGCTGGGAGCGG + Intergenic
975753581 4:77550057-77550079 GGCAGCAGCAAGGCTGGGAGAGG - Intronic
976356720 4:84127202-84127224 GGCCCCAGGAGGGCTGGGGGAGG + Intergenic
976524927 4:86075982-86076004 GGCCCCAGGAGGGCTGGGGGAGG - Intronic
982219484 4:153112418-153112440 GACCACAGCAGGGCTGGGTGTGG - Intergenic
983364642 4:166769896-166769918 GACAGCAGCAAGGCTGGGGGAGG - Intronic
985558281 5:568757-568779 GGCACCAGGAGGGCCAGGGGCGG - Intergenic
985744604 5:1638953-1638975 CACACCAGCTGGGCGGGGAGGGG - Intergenic
986151352 5:5133106-5133128 GCCAGCAGGAGAGCTGGGGGAGG - Intergenic
986227361 5:5828322-5828344 GAGACCAGCAGGGCTGAGAGTGG + Intergenic
986707557 5:10464082-10464104 GAGACGAGGACGGCTGGGACAGG - Intronic
986817652 5:11430136-11430158 GACACCTGGGAGGCTGGGACAGG + Intronic
990311297 5:54541316-54541338 AAGACCAGGAGGGCCGGGCGCGG - Intronic
990643300 5:57813697-57813719 GCCACCGTGGGGGCTGGGAGGGG + Intergenic
990900320 5:60742999-60743021 AGGACCAGGAGGGATGGGAGGGG - Intergenic
991130890 5:63121290-63121312 GACCCCTGGAGTGCAGGGAGTGG + Intergenic
991545803 5:67780439-67780461 GGCAGCAGCAGGGCTGGGGGAGG + Intergenic
992472050 5:77067506-77067528 GAGACCAGGAAAGCTGGCAGTGG - Intergenic
994510388 5:100696059-100696081 GACAGCAGGAGAGTGGGGAGAGG - Intergenic
994688113 5:102982267-102982289 GACACCAGCAGTGGTGGTAGTGG - Intronic
995528173 5:113067317-113067339 GACACCTGGAGACCTGGCAGGGG + Intronic
996760671 5:126983279-126983301 GGCTCCAGGAGGGCAGGGAAGGG + Intronic
997326533 5:133026453-133026475 GTCCACTGGAGGGCTGGGAGCGG - Intronic
998874477 5:146585677-146585699 GCCACCATGGGGTCTGGGAGAGG + Intronic
999224364 5:150008551-150008573 CACACCAGGCAGTCTGGGAGAGG - Intronic
999318659 5:150600257-150600279 GACGTCAGCAGGGCTGGGAATGG - Intergenic
999759943 5:154692080-154692102 GGGACCAGCAGGGCTGGGAGCGG - Intergenic
1001043469 5:168353495-168353517 GGCAGCAGGAGGCCTGAGAGAGG - Intronic
1001401909 5:171450998-171451020 GACCCCAGGAGGGCTGCGCGGGG + Intronic
1001555001 5:172631159-172631181 GACACCAGCTGGGCTGTGATGGG + Intergenic
1001933553 5:175689264-175689286 GACACCATGTGGGCTGAGGGGGG - Intergenic
1002075962 5:176708693-176708715 CACATTTGGAGGGCTGGGAGGGG - Intergenic
1002346900 5:178554467-178554489 CACACCAGGAGGGCTGGGCGTGG - Intronic
1002641416 5:180632313-180632335 GACACCACGTGGCCTGGGAAGGG - Intronic
1002924005 6:1594594-1594616 GACACCCTGGGTGCTGGGAGGGG - Intergenic
1003533654 6:6957531-6957553 CACATCATGAGGGCTGGGCGCGG + Intergenic
1004118056 6:12790494-12790516 GAAAGCAAGAGGGCTGGGAATGG - Intronic
1004156317 6:13171311-13171333 GAAACCTGGAGTGCTGGGATGGG - Intronic
1005043722 6:21622162-21622184 GACATAAAAAGGGCTGGGAGTGG - Intergenic
1005813693 6:29533838-29533860 GACCCCCAGAGGGCTGGGAAGGG + Intergenic
1005869811 6:29966344-29966366 GACCCCAGGAGGTCTTGGGGAGG - Intergenic
1006745471 6:36338873-36338895 GACTCCATGAGGGCTGGGCCAGG - Intergenic
1007073524 6:39052926-39052948 GACACCAGGAGGGAGTGGTGTGG - Intronic
1007175829 6:39896802-39896824 GCCAACAGGATGGCTGGGAGAGG - Exonic
1007595312 6:43047460-43047482 GACACCTGGATGGCTGGGAAGGG + Intronic
1007634084 6:43287596-43287618 GTCACCAGGAGAGGTGGGGGAGG + Exonic
1007726078 6:43916425-43916447 GAGAAGAGGAGGGCTGTGAGGGG - Intergenic
1008658693 6:53643636-53643658 GGCATCAGTGGGGCTGGGAGAGG + Intergenic
1008838666 6:55869945-55869967 GACCCCAGGAAGTGTGGGAGTGG + Intronic
1008899161 6:56591680-56591702 AACATCAGGAAGGCTGGGCGCGG + Intronic
1009864964 6:69386045-69386067 AACACCAGTTGAGCTGGGAGTGG + Intronic
1009918822 6:70030874-70030896 GAGAGCAGGATGGCTGGGACAGG - Intronic
1011293743 6:85805476-85805498 GACACAAAGACGGCTGGGCGCGG - Intergenic
1011524931 6:88254015-88254037 GGCAGCAGCAAGGCTGGGAGAGG + Intergenic
1012602702 6:101117497-101117519 GACAGCAGCAGAGCTGGGCGGGG - Intergenic
1013185271 6:107752170-107752192 GACACCAGGAGGGCTCTAGGTGG + Intronic
1013279980 6:108627049-108627071 GACACCAGGCAGGCAGGTAGGGG + Intronic
1016507511 6:144799105-144799127 CAAATCAGGAGGGCTGGGATTGG + Intronic
1017919030 6:158855594-158855616 GTCAACAGGAGGGCCGGGCGCGG - Intergenic
1018395768 6:163377103-163377125 GGCTGCAGGAAGGCTGGGAGGGG - Intergenic
1018629464 6:165809746-165809768 CCCACTAGGAGGGCTGGGAAGGG - Intronic
1018852694 6:167652805-167652827 ACCACCAGGAGGGCTGGACGGGG + Intergenic
1018949888 6:168372188-168372210 GTTCCCCGGAGGGCTGGGAGGGG + Intergenic
1019062469 6:169266150-169266172 GAGACCAGGAGGAGAGGGAGGGG + Intergenic
1019164502 6:170088935-170088957 GACACCAGCTGGGCTGGGTGCGG + Intergenic
1019354324 7:570883-570905 GACACAGAGAGTGCTGGGAGTGG - Intronic
1019930349 7:4218676-4218698 GACAGCAGGAGGGCAGGGCTGGG + Intronic
1019960176 7:4452443-4452465 GACAGCTGGAGGCCTGGGTGAGG - Intergenic
1020208588 7:6139933-6139955 AACACAGGGAGGTCTGGGAGTGG - Intronic
1021506512 7:21391514-21391536 AACACCAGAAGAGCTGGAAGCGG + Intergenic
1022127887 7:27375593-27375615 GACACTAGGAGGGCTCTGTGGGG - Intergenic
1022470168 7:30677117-30677139 GATAGAAGGAGGGATGGGAGTGG + Intronic
1022479206 7:30732129-30732151 AACACCAGGAGCCCTGGCAGGGG + Intronic
1022507787 7:30917307-30917329 GACCCAAGGAGGGTTGGGCGGGG + Intronic
1025207467 7:57002035-57002057 GGCACCAGGAGGGCCGGGGATGG - Intergenic
1025247676 7:57329245-57329267 GAGACCAGCTGGGCTTGGAGAGG - Intergenic
1025663196 7:63567962-63567984 GACATCAGGATGGCAGGTAGGGG + Intergenic
1025664468 7:63574851-63574873 GGCACCAGGAGGGCCGGGGATGG + Intergenic
1025840340 7:65141050-65141072 GACGCCAGTAGAGCTGGCAGCGG - Intergenic
1025878373 7:65509100-65509122 GACGCCAGTAGAGCTGGCAGCGG + Intergenic
1025882720 7:65554914-65554936 GACGCCAGTAGAGCTGGCAGCGG + Intergenic
1025890723 7:65647689-65647711 GACGCCAGTAGAGCTGGCAGCGG - Exonic
1027053269 7:75032779-75032801 TACCACAGGAGGGCTGGGTGCGG + Intronic
1029359896 7:100081158-100081180 GTTAGCACGAGGGCTGGGAGTGG - Intronic
1029381940 7:100220481-100220503 GGGTCCAGGAGGGCAGGGAGGGG + Intronic
1029402104 7:100352931-100352953 GGGTCCAGGAGGGCAGGGAGGGG + Intronic
1029436814 7:100568300-100568322 GGCAGCAGCAGGACTGGGAGGGG + Intergenic
1029655110 7:101919067-101919089 TCCAGCAGGAGGGCTGGGCGCGG - Intronic
1030318668 7:108141884-108141906 GGAAACAGGAGGGCTGGGAGGGG + Intergenic
1030807940 7:113938819-113938841 GACAACATGCGGGCTGGGAGTGG + Intronic
1032077899 7:128844721-128844743 GACACCAAGGGGGCTGGCACAGG + Exonic
1032096003 7:128938830-128938852 GACCCCGGGAGGGGCGGGAGCGG + Intronic
1032511370 7:132475231-132475253 ATCCCAAGGAGGGCTGGGAGGGG - Intronic
1033195217 7:139321665-139321687 GACAGCAGGTGGCCTGGGGGTGG + Intergenic
1033422698 7:141217495-141217517 GACCCCAGGGAGGCTGGCAGAGG + Intronic
1034306579 7:150048762-150048784 GCCACCAGGAGGGCGCGGGGTGG + Intergenic
1034800267 7:154051881-154051903 GCCACCAGGAGGGCGCGGGGTGG - Intronic
1035563938 8:628849-628871 CACAGCAGGGGAGCTGGGAGAGG - Intronic
1036492673 8:9242457-9242479 AACACCTGGAAGTCTGGGAGAGG - Intergenic
1036784486 8:11677070-11677092 GTCACCAGGAGGGCCAGGAGGGG - Intronic
1037755008 8:21704929-21704951 GACTCCAGGAGGGGTGGGAGGGG + Intronic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038425624 8:27462192-27462214 GACCCCAGGCAGGCTGGGGGTGG + Intronic
1038472590 8:27837902-27837924 GGCACCGGGAGTCCTGGGAGAGG - Exonic
1038635395 8:29282573-29282595 GACACCAAAAAGGCTGGGTGTGG - Intergenic
1039474693 8:37833486-37833508 TACACCAGGGGTGCTGGCAGTGG + Intronic
1039542155 8:38381646-38381668 GACCCCAGGAGGAATGGAAGGGG - Intronic
1039907231 8:41795741-41795763 GAGACCAGGAAGGGTGGGTGGGG + Intronic
1040509873 8:48084363-48084385 GAGTCCCTGAGGGCTGGGAGTGG + Intergenic
1041314889 8:56550731-56550753 GGCAGCAGCAAGGCTGGGAGAGG + Intergenic
1041466237 8:58160153-58160175 GGCAACAGGAAGGCTTGGAGAGG - Intronic
1042201616 8:66284294-66284316 GAAACAAAGAGGGCTGGGCGTGG + Intergenic
1042215573 8:66427709-66427731 GAAACAAGGAGGGCTCAGAGAGG - Intergenic
1043584369 8:81750307-81750329 AAGACAAGGAGGGCTGGGTGTGG + Intronic
1045687145 8:104723908-104723930 GCCACTGGGAGGGCAGGGAGAGG + Intronic
1047212900 8:122854135-122854157 GACACCAGGCATGCTGTGAGAGG - Intronic
1047655278 8:126970504-126970526 GACATCATGGGGGCAGGGAGGGG + Intergenic
1047681345 8:127257559-127257581 AACTGCAGAAGGGCTGGGAGAGG + Intergenic
1048005482 8:130416160-130416182 GACACTAGTGGGGCGGGGAGTGG - Intronic
1048184513 8:132227348-132227370 GACACCAGTGGGGCCGGGTGTGG - Intronic
1048317863 8:133375393-133375415 GGCTCCAGGAGGGCTGGGGCAGG + Intergenic
1048377317 8:133834023-133834045 GGCAGCAGCAGAGCTGGGAGAGG + Intergenic
1049377953 8:142298028-142298050 GGTAGCAGGGGGGCTGGGAGTGG - Intronic
1049399599 8:142419011-142419033 GAGAGCATGAGGGCTGGCAGAGG - Intergenic
1049446571 8:142634171-142634193 GACAGCAGAAGGTATGGGAGGGG + Intergenic
1049537376 8:143188659-143188681 GACCTCAGGATGGGTGGGAGGGG + Intergenic
1049548845 8:143247053-143247075 GACTGCTGGAGGGCGGGGAGAGG - Intergenic
1051776314 9:20637996-20638018 GACACTAGGAAGGGTGGGGGTGG + Intergenic
1052988843 9:34506811-34506833 TGCAGAAGGAGGGCTGGGAGTGG - Exonic
1055584680 9:77745898-77745920 GGCCCCAGAAGGGCTGGGGGTGG + Intronic
1056000446 9:82210672-82210694 GGCACAAGCTGGGCTGGGAGAGG + Intergenic
1056235242 9:84587872-84587894 GAAACCAGGGGGGCTGGGTTTGG + Intergenic
1057523965 9:95783638-95783660 GACACCTGGAGCGGTTGGAGCGG + Intergenic
1058202993 9:102066900-102066922 GACAGCAGCCTGGCTGGGAGAGG - Intergenic
1059884379 9:118728802-118728824 GACACCAGGATGAAAGGGAGAGG - Intergenic
1060263511 9:122095309-122095331 GACACCTGGAGAGATGAGAGAGG - Intergenic
1060477185 9:123995652-123995674 GAGACAAGGAGAGCTGGGTGCGG - Intergenic
1060595627 9:124846623-124846645 GAAAACAGGAGGGCTGGGCGCGG - Intergenic
1061093277 9:128439029-128439051 GGCAGCTGGAGGGGTGGGAGGGG + Intergenic
1061164010 9:128911949-128911971 GTGACCAGGAGGGGTGGGCGTGG + Intronic
1061621442 9:131813748-131813770 AACAACAGCAGGGCTGGGTGCGG - Intergenic
1062186711 9:135222207-135222229 GCCACCAGCAGGGGTGGCAGAGG + Intergenic
1062214684 9:135382848-135382870 GACGCCAGCAGGACTGTGAGTGG - Intergenic
1062346960 9:136119290-136119312 GGCTCCAGGAGGGCGGGGAAGGG + Intergenic
1062431275 9:136527823-136527845 GACTCCAGGAGGGCTGCGGGGGG + Intronic
1062598734 9:137310790-137310812 GACATCAGAAGGGCTGTGACGGG - Intronic
1062607070 9:137353187-137353209 GAGGCCAGGAGGGCTGGTGGAGG - Intronic
1062607102 9:137353295-137353317 GAGAGCAGGAGGGCCGGCAGAGG - Intronic
1186016283 X:5198659-5198681 GAAATCAGCAGGGCTGGGCGCGG + Intergenic
1186386613 X:9116396-9116418 GACATCAGCAGGGCTGGGGATGG - Intronic
1186473028 X:9836070-9836092 CACACCTGGAGAGCGGGGAGGGG + Intronic
1186793957 X:13025848-13025870 GACATCATGGGTGCTGGGAGTGG + Intergenic
1187963527 X:24588306-24588328 GACAGCAGGATGGCTTGGAGAGG - Intronic
1188006678 X:25020684-25020706 GAAACCTGGAGGGATGGGTGCGG - Intergenic
1188119572 X:26287456-26287478 GAAAAGAGGAGGGGTGGGAGAGG - Intergenic
1189899714 X:45693526-45693548 GAGACCTGGATGGGTGGGAGGGG + Intergenic
1190243786 X:48677178-48677200 GACACCCCCAGGGCTGGGACAGG - Intronic
1192499367 X:71639411-71639433 GACAGCAGGAGGCCAAGGAGAGG - Intergenic
1192995908 X:76513133-76513155 GCAAACAGGAGGGTTGGGAGTGG - Intergenic
1195707203 X:107746176-107746198 GACTGCAGGTGGCCTGGGAGAGG + Intronic
1197804117 X:130383121-130383143 GAGACCAGGAGGTTTTGGAGAGG + Intergenic
1198089259 X:133311679-133311701 GACTCCAGGAGGGAAGGGGGTGG - Intronic
1199848304 X:151707380-151707402 GTTACCAGTAGGGCAGGGAGAGG - Intergenic
1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG + Intergenic
1200327813 X:155260881-155260903 CAATCCAGGAGGGCTGGGAAGGG - Exonic
1201305153 Y:12543340-12543362 GACACTAGGAGGTATGGGAAAGG - Intergenic