ID: 1200093862

View in Genome Browser
Species Human (GRCh38)
Location X:153648190-153648212
Sequence GGCCCCCGCCCTGGTCGTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 71}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200093862_1200093877 19 Left 1200093862 X:153648190-153648212 CCTGTACGACCAGGGCGGGGGCC 0: 1
1: 0
2: 2
3: 1
4: 71
Right 1200093877 X:153648232-153648254 CGAGGCCGAGGCCGAGGAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 345
1200093862_1200093869 -5 Left 1200093862 X:153648190-153648212 CCTGTACGACCAGGGCGGGGGCC 0: 1
1: 0
2: 2
3: 1
4: 71
Right 1200093869 X:153648208-153648230 GGGCCGGCGCCGGCGCGGGGAGG 0: 1
1: 1
2: 19
3: 174
4: 1367
1200093862_1200093866 -10 Left 1200093862 X:153648190-153648212 CCTGTACGACCAGGGCGGGGGCC 0: 1
1: 0
2: 2
3: 1
4: 71
Right 1200093866 X:153648203-153648225 GGCGGGGGCCGGCGCCGGCGCGG 0: 1
1: 0
2: 22
3: 180
4: 1334
1200093862_1200093878 22 Left 1200093862 X:153648190-153648212 CCTGTACGACCAGGGCGGGGGCC 0: 1
1: 0
2: 2
3: 1
4: 71
Right 1200093878 X:153648235-153648257 GGCCGAGGCCGAGGAGTGGGAGG 0: 1
1: 0
2: 3
3: 55
4: 559
1200093862_1200093871 1 Left 1200093862 X:153648190-153648212 CCTGTACGACCAGGGCGGGGGCC 0: 1
1: 0
2: 2
3: 1
4: 71
Right 1200093871 X:153648214-153648236 GCGCCGGCGCGGGGAGGCCGAGG 0: 1
1: 0
2: 13
3: 75
4: 661
1200093862_1200093876 18 Left 1200093862 X:153648190-153648212 CCTGTACGACCAGGGCGGGGGCC 0: 1
1: 0
2: 2
3: 1
4: 71
Right 1200093876 X:153648231-153648253 CCGAGGCCGAGGCCGAGGAGTGG 0: 1
1: 0
2: 8
3: 48
4: 374
1200093862_1200093868 -8 Left 1200093862 X:153648190-153648212 CCTGTACGACCAGGGCGGGGGCC 0: 1
1: 0
2: 2
3: 1
4: 71
Right 1200093868 X:153648205-153648227 CGGGGGCCGGCGCCGGCGCGGGG 0: 1
1: 1
2: 15
3: 129
4: 965
1200093862_1200093874 13 Left 1200093862 X:153648190-153648212 CCTGTACGACCAGGGCGGGGGCC 0: 1
1: 0
2: 2
3: 1
4: 71
Right 1200093874 X:153648226-153648248 GGAGGCCGAGGCCGAGGCCGAGG 0: 4
1: 17
2: 39
3: 319
4: 1359
1200093862_1200093867 -9 Left 1200093862 X:153648190-153648212 CCTGTACGACCAGGGCGGGGGCC 0: 1
1: 0
2: 2
3: 1
4: 71
Right 1200093867 X:153648204-153648226 GCGGGGGCCGGCGCCGGCGCGGG 0: 1
1: 1
2: 20
3: 290
4: 1580
1200093862_1200093873 7 Left 1200093862 X:153648190-153648212 CCTGTACGACCAGGGCGGGGGCC 0: 1
1: 0
2: 2
3: 1
4: 71
Right 1200093873 X:153648220-153648242 GCGCGGGGAGGCCGAGGCCGAGG 0: 1
1: 0
2: 6
3: 107
4: 917

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200093862 Original CRISPR GGCCCCCGCCCTGGTCGTAC AGG (reversed) Exonic
900349571 1:2228222-2228244 GGCGCCCGCCCGGCTCGTCCCGG - Intergenic
903226203 1:21895332-21895354 AGCCCCCACCCTGGTCAGACTGG - Intronic
904290511 1:29482779-29482801 GGCCCCCACCCTGGTGCTCCTGG + Intergenic
906033027 1:42735323-42735345 GCCCCCAGCCCTGGGCGCACTGG + Intronic
911377358 1:97067548-97067570 AGCCCCTGCCCTGTTCCTACAGG + Intergenic
1062916411 10:1243895-1243917 TGCCCCCTCCCTGGTGGGACGGG + Intronic
1073266395 10:102230759-102230781 GGCCCCCGCCCAGGCCCTGCAGG + Exonic
1075521944 10:123148444-123148466 GGCCCCCGCCCAGGATGGACTGG - Exonic
1075689831 10:124387391-124387413 GGCCCCGGCCCTGCTCTGACAGG - Intergenic
1077376851 11:2209276-2209298 GGCCCCTGCCCTGCTCTGACAGG - Intergenic
1077410814 11:2403170-2403192 GGCCACCGCCCTGGCCTTCCTGG + Exonic
1077933072 11:6753788-6753810 GGCCCCGTTCCTGGTGGTACTGG + Intergenic
1078210236 11:9264829-9264851 CGCGCCCGCCCTGGTCCTCCCGG + Intronic
1079616832 11:22505429-22505451 AGCCCCCGCCCTCGCCATACAGG + Intergenic
1083828741 11:65217728-65217750 CGCCCCCGCCCTGCTCTTTCAGG - Intergenic
1083915273 11:65739026-65739048 GGCCCCACTCCTGGTGGTACTGG + Intergenic
1088764756 11:112963568-112963590 GGCCCCCGCCCAGGTGGCAGCGG - Intronic
1092244413 12:6855524-6855546 TGCCCCAGCCCTGCTCCTACCGG - Exonic
1111431246 13:88150710-88150732 GGCTCCAGTCCTGGTGGTACTGG + Intergenic
1116239537 14:42323423-42323445 GGCCCCAATCCTGGTGGTACTGG + Intergenic
1118770234 14:68938005-68938027 GGCCCACGCCCTGGCCAGACTGG - Intronic
1129253114 15:74319457-74319479 GGCCCCAGTCCTGGTCTCACAGG - Intronic
1129606946 15:77029593-77029615 GGCCTCCGCCCTGGTCGGACGGG - Intronic
1138105063 16:54283703-54283725 GGACGCCGCCCTGGTCTTATCGG - Exonic
1142849577 17:2697861-2697883 GGCCCCGGCCCTGGTCCGGCAGG + Intronic
1144657119 17:17043675-17043697 GGCCCCCGCCCTGGAGTGACTGG + Intronic
1149993652 17:61396248-61396270 GGCCCCGTCCCTGGTCTTCCCGG - Intergenic
1152407201 17:80104597-80104619 GGCACCCGCCCTGCTCCCACCGG + Intergenic
1157433750 18:47651641-47651663 GGCCCCCCACCTGGTCCTAGAGG - Intergenic
1160680502 19:409847-409869 GGCCCCAGCCCTGGTGATGCAGG + Intergenic
1161321614 19:3644114-3644136 GGGCCCCCCGCAGGTCGTACTGG + Exonic
1162659703 19:12159419-12159441 GGCCCCCACCCTGGGGATACTGG - Intergenic
1163168184 19:15511868-15511890 GGCCCACGCCCAGGTCGCGCTGG - Intronic
1165111857 19:33507206-33507228 GTCCCCCGACCTGGTCAAACTGG + Intronic
1167334885 19:48878775-48878797 GGCCCACGCCCTGGTTTTTCAGG + Intergenic
1168694489 19:58396841-58396863 GGCCCCCGCCGGGGTCGCCCTGG + Exonic
925208433 2:2026714-2026736 GGGCCCCGCCCTGGACGGAGAGG - Intronic
928123297 2:28599296-28599318 GGCCCCCACCCTGCTCCTAGAGG + Intronic
948627392 2:239277427-239277449 GGCCACCACCCTGGGAGTACGGG + Intronic
1171461168 20:25298830-25298852 GGCCTCAGACCTGGTCGTGCAGG + Intronic
1182108181 22:27704203-27704225 GGCACCCCCCATGGTGGTACGGG - Intergenic
1183715607 22:39531734-39531756 GGCACCTGCCCAGGTGGTACAGG - Intronic
1184412084 22:44331460-44331482 GGCCCCCGCCCTGCCCGCCCCGG + Intergenic
1185417977 22:50720440-50720462 GGGCCGCGCCCGGCTCGTACAGG - Intergenic
971364546 4:25967293-25967315 GGCCCCCGCACTGGTGGTGAAGG - Intergenic
991963417 5:72067875-72067897 AGCCCACGCCCTGCTCATACAGG - Intergenic
997269735 5:132526587-132526609 GGCCCCCACACTGGGCGCACAGG - Intergenic
998267889 5:140679814-140679836 GCTCCCCGCCCTGGTCCTTCAGG + Exonic
1001070190 5:168579236-168579258 GGCCCCAGCCCCCGTCTTACAGG + Exonic
1002460155 5:179369310-179369332 GGCCCCTGCACTGGTCTTGCGGG - Intergenic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1006434646 6:34019896-34019918 GGCCCCAGCCCTGGCTGCACTGG + Intronic
1019194420 6:170272836-170272858 CGCCCCTGCCCTGGCCGCACAGG + Intergenic
1019572265 7:1718760-1718782 GGCCCCCTCCCTGGCCGTGTTGG + Intronic
1024666091 7:51548640-51548662 AGCCCCTGCCCTGCTTGTACAGG + Intergenic
1025730277 7:64101950-64101972 GGGCCCCACCCTGGGCGTGCTGG + Intronic
1026976098 7:74499319-74499341 GGCTCCCGCCTAGGTCATACTGG - Intronic
1026981125 7:74527121-74527143 GGCCCCGTCCATGGTCATACGGG + Intronic
1029110111 7:98209737-98209759 GGCCCCTGCCCTGGTCCCTCTGG + Intergenic
1030740470 7:113103264-113103286 GGCCCTCTCCCTGGTTGTAGAGG + Intergenic
1033436258 7:141336135-141336157 TGGCCCCGCCCTGGTCATCCTGG + Intronic
1037926275 8:22846284-22846306 GGAGCCAGCCCTGGTCGTGCAGG - Intronic
1038000242 8:23385132-23385154 CGCCCCCGTCCTGTTCGAACAGG + Intronic
1043692276 8:83169151-83169173 GGCCACCGCACTGGTCTAACTGG + Intergenic
1050992751 9:12173545-12173567 GGCCCCACTCCTGGTGGTACTGG + Intergenic
1057500893 9:95596005-95596027 GGCCCCCGCGCTGGTCTGAGTGG - Intergenic
1062410795 9:136423230-136423252 GGCGCCTGCCCAGGACGTACCGG + Exonic
1062585994 9:137250355-137250377 GGCCCCTGCCCAGGTTGTGCCGG - Intergenic
1062622946 9:137430801-137430823 CGCCCCAGCCCTGGTCGTCGGGG - Exonic
1203774458 EBV:65017-65039 GGGACACGCCCTGGTCGGACTGG + Intergenic
1186805771 X:13139182-13139204 GGCCCCCGCCCTGCTCTCACAGG + Intergenic
1188005552 X:25013712-25013734 GGCCCCCGCCCGGGCCGTACAGG + Exonic
1200093862 X:153648190-153648212 GGCCCCCGCCCTGGTCGTACAGG - Exonic
1200138465 X:153886024-153886046 GGCCGCGGCCCGGGTCGCACGGG + Intronic
1200234419 X:154461416-154461438 GGCCCAGGCCCTGGGCGTGCCGG + Exonic