ID: 1200093870

View in Genome Browser
Species Human (GRCh38)
Location X:153648211-153648233
Sequence CGGCCTCCCCGCGCCGGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 0, 2: 6, 3: 62, 4: 374}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200093870_1200093883 17 Left 1200093870 X:153648211-153648233 CCGGCGCCGGCGCGGGGAGGCCG 0: 1
1: 0
2: 6
3: 62
4: 374
Right 1200093883 X:153648251-153648273 TGGGAGGCCGAGTCGGTGCTGGG 0: 1
1: 0
2: 1
3: 20
4: 280
1200093870_1200093874 -8 Left 1200093870 X:153648211-153648233 CCGGCGCCGGCGCGGGGAGGCCG 0: 1
1: 0
2: 6
3: 62
4: 374
Right 1200093874 X:153648226-153648248 GGAGGCCGAGGCCGAGGCCGAGG 0: 4
1: 17
2: 39
3: 319
4: 1359
1200093870_1200093882 16 Left 1200093870 X:153648211-153648233 CCGGCGCCGGCGCGGGGAGGCCG 0: 1
1: 0
2: 6
3: 62
4: 374
Right 1200093882 X:153648250-153648272 GTGGGAGGCCGAGTCGGTGCTGG 0: 1
1: 0
2: 0
3: 26
4: 275
1200093870_1200093877 -2 Left 1200093870 X:153648211-153648233 CCGGCGCCGGCGCGGGGAGGCCG 0: 1
1: 0
2: 6
3: 62
4: 374
Right 1200093877 X:153648232-153648254 CGAGGCCGAGGCCGAGGAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 345
1200093870_1200093881 10 Left 1200093870 X:153648211-153648233 CCGGCGCCGGCGCGGGGAGGCCG 0: 1
1: 0
2: 6
3: 62
4: 374
Right 1200093881 X:153648244-153648266 CGAGGAGTGGGAGGCCGAGTCGG 0: 1
1: 0
2: 1
3: 19
4: 334
1200093870_1200093878 1 Left 1200093870 X:153648211-153648233 CCGGCGCCGGCGCGGGGAGGCCG 0: 1
1: 0
2: 6
3: 62
4: 374
Right 1200093878 X:153648235-153648257 GGCCGAGGCCGAGGAGTGGGAGG 0: 1
1: 0
2: 3
3: 55
4: 559
1200093870_1200093876 -3 Left 1200093870 X:153648211-153648233 CCGGCGCCGGCGCGGGGAGGCCG 0: 1
1: 0
2: 6
3: 62
4: 374
Right 1200093876 X:153648231-153648253 CCGAGGCCGAGGCCGAGGAGTGG 0: 1
1: 0
2: 8
3: 48
4: 374

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200093870 Original CRISPR CGGCCTCCCCGCGCCGGCGC CGG (reversed) Exonic
900227732 1:1540726-1540748 AGGCCGCCCCGTGCCAGCGCCGG + Intergenic
900427555 1:2587438-2587460 CTGCCTCCCCGCCCCGCAGCTGG + Intronic
900604110 1:3516226-3516248 CCGCCTCCCTGCGCCAGCTCAGG - Intronic
900630647 1:3633424-3633446 CCGCCGCCCCGGGCCGGGGCCGG - Exonic
901056157 1:6449405-6449427 GGGCCTCCCAGCTCTGGCGCTGG + Intronic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901443393 1:9292939-9292961 CAGGCTCCAGGCGCCGGCGCCGG + Exonic
901934526 1:12618384-12618406 CGCGCTCCCCGCGACGGCGCAGG - Intergenic
902251015 1:15154131-15154153 CGGCCGCGCCCCGCCGGCGCGGG + Intronic
902768549 1:18632422-18632444 GGGTCTCCCCGGGCGGGCGCTGG - Intronic
903142249 1:21345620-21345642 TGCACTCCCCGCGCCCGCGCGGG + Intergenic
903193576 1:21669465-21669487 CTGCCGCCCCGCCCCGCCGCAGG + Intergenic
903493092 1:23743937-23743959 TGGCCTCCCGGTGCCTGCGCTGG + Intronic
903555069 1:24187262-24187284 CGGCGTCCCCGCCCGGGCCCAGG + Intronic
903875878 1:26472732-26472754 CAGCCTCCCCGCGCGGGGGCTGG + Intronic
906120914 1:43389942-43389964 CAGCCCTCCCGCGCCGGCCCGGG - Intronic
906130713 1:43453718-43453740 CGGCCTCCCCGCGCGGGTGCGGG - Exonic
907258328 1:53197010-53197032 CGGCCCCTCAGCGCCGGCTCCGG + Exonic
907440362 1:54474921-54474943 CGGCAGCCCCGCCCGGGCGCAGG + Intergenic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
908780395 1:67685341-67685363 CGGCCGCCCCTCGCCCGCCCGGG - Exonic
910771478 1:90836129-90836151 TCGCCTCCCCGCCCCGGCACGGG + Intergenic
910892207 1:92029961-92029983 CGGCCGCCCCGGGCCGGGGGAGG + Exonic
912798593 1:112707155-112707177 CGCCCTCCCCGCCGCGGCGCTGG - Intronic
915549861 1:156625548-156625570 CCGCCTCCCCTCCCCGCCGCCGG - Exonic
915559217 1:156676745-156676767 CGGGCCTCCCGCGCCGGCCCCGG - Exonic
915588987 1:156860125-156860147 CGGCCAGCCAGCGCCGGCCCCGG - Intronic
916106991 1:161440256-161440278 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916108552 1:161447670-161447692 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916110140 1:161455051-161455073 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916111725 1:161462461-161462483 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
916113312 1:161469842-161469864 CAGCCCCGCCGCGCCGGCCCGGG + Intergenic
919101850 1:193105490-193105512 CGGACTGCCCGCGCCGCCGCCGG + Intronic
919640390 1:200039868-200039890 CTCCCGCCCCGCGCGGGCGCGGG + Intronic
920021280 1:202958280-202958302 CGCCCTCCCCGCGCCGGAAGGGG + Exonic
921355426 1:214281006-214281028 CGGCCGCCCCGCGCGCGCTCCGG - Intergenic
922416675 1:225428241-225428263 CGGCCTCCCCGCCCCCAGGCAGG - Intronic
922526658 1:226309297-226309319 CCTCCTCCCCGGGCAGGCGCGGG - Exonic
922558131 1:226548709-226548731 CGCCCTCCCCGCCCCTCCGCCGG + Intergenic
922739389 1:228006919-228006941 CCGCCGCCCCGCGCCGCCCCGGG + Intergenic
924172439 1:241356756-241356778 CGGGAGCCCCGCGCCGGGGCTGG - Intronic
924823625 1:247518171-247518193 TGGCCTGGCCGCGCCGGCTCCGG + Intronic
1063504016 10:6580174-6580196 CTCCCTCCCGGCGGCGGCGCGGG + Intronic
1065240180 10:23695982-23696004 CGCTCTCCCCGCGCCGCTGCGGG + Intronic
1066135912 10:32446151-32446173 CGGGCACCCGCCGCCGGCGCCGG - Exonic
1071579685 10:86757245-86757267 CAGCCTCGCCGCTCCGGGGCGGG - Intronic
1071997555 10:91162973-91162995 CGCCCCGCCCCCGCCGGCGCGGG + Intergenic
1072059739 10:91798475-91798497 CGGCTGCCCCGCGGCGGCGGAGG - Exonic
1072591630 10:96832735-96832757 CGGCGCCCCGGCGCCGCCGCCGG + Intronic
1073207424 10:101776285-101776307 CGGCCGCCCCGCCCCCGCCCCGG - Intronic
1073325758 10:102643464-102643486 CGGCCTGGCCCCGCCGCCGCAGG + Intergenic
1075031941 10:119029750-119029772 CGTCCGGCCCGCGCCGGCGGCGG + Exonic
1075999842 10:126905727-126905749 CGGCCGCCCCGCGCCCCCGGCGG + Intronic
1076792456 10:132784652-132784674 CCGCCTCCTCGCGCCTGCCCGGG + Intergenic
1076798080 10:132808477-132808499 CGGCCTCCCCTTGGCGGCGCTGG - Exonic
1076935593 10:133566229-133566251 CGGCCTCCCCTGGCCGGTGAAGG - Intronic
1077063190 11:626612-626634 TGGCCTCCCCGGGTCAGCGCTGG - Intronic
1077200471 11:1304533-1304555 CGGCCGCCCCGTCCTGGCGCGGG - Intronic
1077214627 11:1390251-1390273 CGGGCGCCCCTGGCCGGCGCCGG + Intronic
1078233214 11:9461130-9461152 CGCCCTCAGCGCGGCGGCGCGGG + Intronic
1078352684 11:10607598-10607620 AGGCCTCCCCGCCCCAGCACAGG - Intronic
1078371631 11:10751284-10751306 CTGCCGCCCCGCGGCGCCGCTGG - Exonic
1081845524 11:46238107-46238129 CGGCCTCCCCGCGGGGCTGCAGG + Intergenic
1082824465 11:57567746-57567768 GGGCCTCCCCGCACCCGCTCCGG + Exonic
1083758453 11:64803331-64803353 GGGCTTCCCCGCGCCGCCGAGGG - Intergenic
1083936652 11:65872965-65872987 CCGCCTCCCGGCGCCGGACCAGG + Intronic
1084019477 11:66409224-66409246 GGGACTCCCCGGCCCGGCGCGGG - Intergenic
1084148860 11:67278828-67278850 CGGCCTCACAGAGCAGGCGCAGG + Intronic
1084154831 11:67307712-67307734 CGGCCTCCCAGCGCCGAGCCTGG + Exonic
1084165583 11:67373421-67373443 CGGGAGCCCCGCGCCGGGGCCGG - Intronic
1084546845 11:69818944-69818966 CGCCCGCCCCGCGGCGGCGGCGG + Exonic
1084888120 11:72223828-72223850 CCGGCTCCCCGGGGCGGCGCGGG + Intronic
1089537395 11:119169069-119169091 CGGCCTCCCAGCCAGGGCGCAGG - Exonic
1090780390 11:130002221-130002243 CGGCCTGCGCGCTCCGGCGGCGG - Intronic
1091238561 11:134037383-134037405 CGCCCTCCCCTCCGCGGCGCAGG - Intergenic
1091383657 12:78326-78348 CGGCCTCCACGGGCCGCAGCCGG + Intronic
1091916495 12:4274333-4274355 CGGCCTCCCGGCTCCTGTGCGGG + Intronic
1094192440 12:27711042-27711064 TGGCCTCCCCCGGGCGGCGCTGG - Intronic
1094485997 12:30926568-30926590 CGGCCGCGACGCCCCGGCGCCGG - Intronic
1096240092 12:49955340-49955362 CGGGCTCCGCGTGCCGGTGCCGG + Intronic
1097123226 12:56752357-56752379 CGGCGGCCCCGCGACTGCGCAGG + Intronic
1097234324 12:57529172-57529194 CTGCCTCCCCGGGCCCGCCCTGG + Exonic
1100260523 12:92928879-92928901 CGCCCTCCCCGCCCCCGGGCCGG + Intronic
1101910576 12:108857673-108857695 AGGCCTGCGCGCGCCGGCGCGGG - Intergenic
1103764613 12:123271485-123271507 GGGCATCCCCGGGCCGGGGCCGG + Intronic
1104093280 12:125533665-125533687 CGCCCTCCCCTCCCCGGCGGAGG + Intronic
1104585148 12:130042446-130042468 CAGCCTCCCCGCGCGGGTCCCGG - Intergenic
1104961580 12:132490618-132490640 CGGCCTCCCGGCGCCGGCCACGG - Exonic
1104985143 12:132592404-132592426 CGGCCACCCCAAGCCGGCGCAGG + Intergenic
1105074529 12:133264223-133264245 GAGGCGCCCCGCGCCGGCGCGGG - Intergenic
1106568518 13:30906702-30906724 AAGCCCCCCCGCGCCGCCGCCGG - Exonic
1108643648 13:52406189-52406211 CGCCCTCCCCACGCCGTCGGGGG - Intronic
1111951658 13:94713043-94713065 CAGCCTCCACGCGGCGCCGCAGG + Intergenic
1113793864 13:113045478-113045500 CGGCCTCCACCCGCCGGGACTGG - Intronic
1114031261 14:18583128-18583150 GGGCCTCTCTGCGCCTGCGCCGG - Intergenic
1114031266 14:18583152-18583174 CCCCCTGCCAGCGCCGGCGCAGG + Intergenic
1116426627 14:44798972-44798994 CCACCTCCCCGCTCCTGCGCCGG + Intergenic
1117424616 14:55580812-55580834 CGGCGTCCCCGGGCCGGAGCTGG + Intronic
1118350930 14:64972149-64972171 CAGCGTCCCCGGGCGGGCGCGGG - Exonic
1119519702 14:75277108-75277130 CGGCCTCCCCGGCCCGGCCGCGG - Intergenic
1120809858 14:88792536-88792558 CCGCCTCCCGTCGCCGCCGCGGG - Exonic
1121050452 14:90816362-90816384 CCGCCTCCCGCCGCCGCCGCGGG + Exonic
1122613444 14:103001173-103001195 CAGCCTCCCCGCCCTGGCTCAGG + Intronic
1122645132 14:103189138-103189160 CGCCCTCCCTGCGCCCGCCCAGG - Intergenic
1122719956 14:103716230-103716252 CCGCCTCCCGGCGCCCGCCCTGG - Intronic
1123051605 14:105546839-105546861 CGGCCTCCAGGCGCCGAGGCCGG - Intergenic
1123077017 14:105672542-105672564 CGGCCTCCAGGCGCCGAGGCCGG - Intergenic
1202899758 14_GL000194v1_random:28314-28336 GGGCCTCCCTGCGCCTGCGCCGG + Intergenic
1202899796 14_GL000194v1_random:28398-28420 GGGCCCCACAGCGCCGGCGCAGG - Intergenic
1202918030 14_KI270723v1_random:3143-3165 CGACCTCACCGGGCCAGCGCCGG - Intergenic
1123423275 15:20148388-20148410 GCGCCTCTCCGCGCCAGCGCCGG - Intergenic
1123532496 15:21154909-21154931 GCGCCTCTCCGCGCCAGCGCCGG - Intergenic
1124629475 15:31328259-31328281 CGCCCGCCGCGCGCCGGGGCCGG - Intronic
1124629563 15:31328591-31328613 CGCCCGCCCCGCACCGGCCCAGG - Intronic
1124922233 15:34038640-34038662 CGCCCGTCCCGCGCAGGCGCCGG + Intronic
1124966793 15:34437704-34437726 CGTCCTCGCCGCGCCGCTGCCGG + Intergenic
1124983315 15:34583439-34583461 CGGGGTCCCCGCGGCGCCGCGGG + Intronic
1127117541 15:55743034-55743056 CTGGCTCCCCGCTCCGGCTCCGG + Intronic
1128111165 15:65077073-65077095 CTTCCTCCAGGCGCCGGCGCTGG + Exonic
1128655987 15:69462418-69462440 CGACCTTCACGCGCCAGCGCTGG - Intergenic
1129150334 15:73684355-73684377 CGGACTCCCCGGGCCGCCCCCGG + Exonic
1129612315 15:77070785-77070807 CGGCCCCCGCGCGCCCGCCCAGG + Intronic
1130411672 15:83653640-83653662 CGGCATCCCTGCTCCGGCTCCGG + Intergenic
1131495268 15:92904288-92904310 AGGCCGGCCGGCGCCGGCGCGGG + Intronic
1131799271 15:96053012-96053034 CGGCAGCCCCGCGCTGGCCCCGG + Intergenic
1131838886 15:96416186-96416208 GGGCTTCCCCGCGCCGGCGTGGG + Intergenic
1131892153 15:96984263-96984285 GAGCCTCCCCGCGCCGCCGTGGG - Intergenic
1132453634 16:10599-10621 GGGGCGCGCCGCGCCGGCGCAGG + Intergenic
1132527724 16:425912-425934 GGGCATCCCCTCGGCGGCGCGGG - Exonic
1132734703 16:1379652-1379674 CGGCCGCCCCGCGCCGCCGCCGG + Intronic
1132779368 16:1614361-1614383 CGCCCTCCCGCCGCCGGCCCGGG + Intronic
1132889492 16:2196776-2196798 CGCCCTCCCCGCGCCCGCCCCGG + Intergenic
1133784424 16:8963592-8963614 CCGCCTCCCGCCGCCGGGGCCGG + Intronic
1134121274 16:11586671-11586693 CGGCCTCCCAGCGCTGGTCCCGG - Intronic
1135335732 16:21599680-21599702 CCTCCTCCTCGCCCCGGCGCCGG + Exonic
1135335812 16:21599940-21599962 CGGCCTTCCCGCGCTGGGCCCGG + Intronic
1135407017 16:22206154-22206176 GGGCCTCCTGGCTCCGGCGCTGG - Intergenic
1136560042 16:31033762-31033784 GGGCCTCCCGGCTCTGGCGCCGG + Exonic
1138615031 16:58158396-58158418 AGGCCTCCCCTCGCCCGCTCAGG - Intronic
1139750439 16:69106448-69106470 CCGCCTCCCCGCGCCGGACGCGG - Intronic
1141079293 16:81036262-81036284 CCGGCTTCGCGCGCCGGCGCCGG - Intronic
1141694858 16:85614420-85614442 CCGCCTCCCCTCCCCAGCGCCGG + Intronic
1141959254 16:87393040-87393062 CGGCCTCGCCGCGCCCGGGACGG + Intronic
1142285654 16:89170551-89170573 CGGGCTCCCCGGCCCGGCCCTGG + Intergenic
1142764061 17:2056061-2056083 CGCCCTCCCCGCGCCGGGCCCGG + Intronic
1142811412 17:2397190-2397212 AGGCCTCCCCGCACTGGAGCAGG - Intronic
1142876079 17:2852983-2853005 CGCCCTCCCCGCGCCCACCCGGG - Intronic
1142876205 17:2853418-2853440 CGCCCTCCCCGGCCCGGCCCCGG - Intronic
1143155393 17:4833346-4833368 CGGTCGCTCCGCGCCTGCGCAGG + Intergenic
1143503442 17:7351725-7351747 CGCTCTCTCCGCGGCGGCGCGGG - Intergenic
1143527264 17:7479698-7479720 CGGCCTCCTCTCGGCGGCGGCGG - Intronic
1144586693 17:16491771-16491793 CCGCCTCCTCCCGCCGGCCCTGG + Exonic
1145012649 17:19378567-19378589 CGGCCTCCCGTCCCCAGCGCGGG - Intronic
1145034868 17:19533958-19533980 GGGCCTCCGCGCACTGGCGCGGG - Exonic
1146162924 17:30569705-30569727 CGGCCTCCACACTCAGGCGCAGG + Intergenic
1146183106 17:30709538-30709560 CGGCCCCCTCGCGGCGGCGGAGG - Intergenic
1146284802 17:31567135-31567157 CCCCCTCCCCGCTCCGGCTCTGG - Intergenic
1147044422 17:37742818-37742840 CGGCCTCACCGCTCTGGCGCGGG - Intronic
1147132885 17:38419351-38419373 CGTCCTCGCCGCGCCGGCCCCGG - Intergenic
1147179464 17:38674978-38675000 CGGGCTCGCGGCCCCGGCGCTGG - Exonic
1147200706 17:38799604-38799626 CGGGCTCCCCGGGGCGGGGCGGG - Exonic
1147490881 17:40864922-40864944 CGGCCTCTACGCCCTGGCGCAGG + Exonic
1147560098 17:41503403-41503425 CGGCCTCCACGCTCTGGCGCAGG + Exonic
1147579923 17:41622471-41622493 CGGCCTCCACACTCAGGCGCAGG + Exonic
1147970877 17:44218807-44218829 CGGCCGCTCCGCTCCGGGGCTGG - Intronic
1148558654 17:48593439-48593461 CGCCTTCCCCGCGCCCGCCCAGG - Exonic
1148849327 17:50547245-50547267 CTGCTGCCCCGCGCCGGTGCAGG + Exonic
1149430658 17:56593894-56593916 CTGCCTTCCCGGGCCGGCGGCGG - Exonic
1149491023 17:57085344-57085366 CGGAGTCCGCGCGCCGCCGCCGG - Intronic
1150211873 17:63446267-63446289 CAGCCTCCCCGCGCCGCGCCCGG + Intronic
1150250305 17:63700853-63700875 CGGCCTCCCCAGCCCGTCGCAGG - Intronic
1151585087 17:75003927-75003949 CGGCCTCCACGTGCTGGCTCAGG - Exonic
1151802043 17:76384503-76384525 CGGCCTCAGCGCGCCGCCTCCGG - Intronic
1152758743 17:82097795-82097817 CGGCCTCCCCGCGCCCACAAAGG - Intronic
1152834363 17:82519846-82519868 GGGCCGCTCCGCGCGGGCGCCGG - Exonic
1156119098 18:33820561-33820583 CGGCGCTCCCGGGCCGGCGCGGG - Intergenic
1157849120 18:51030679-51030701 TGGCTTCCCCGCCCCGGGGCGGG + Intronic
1158437953 18:57447255-57447277 CTGCCTCCACGCCCCGGCGCAGG + Intronic
1158602109 18:58864062-58864084 CCTACTCCCCCCGCCGGCGCCGG + Intronic
1160444187 18:78914380-78914402 GGGCCACCCCGCGCTGGCACGGG + Intergenic
1160577308 18:79864033-79864055 CCTCCTCCTCGCGGCGGCGCAGG - Exonic
1160592532 18:79952144-79952166 CGGCCCCCCGGCGACGGCCCCGG - Intergenic
1160653411 19:246523-246545 CGGCGCGCCGGCGCCGGCGCAGG + Intergenic
1160653413 19:246530-246552 GCGCCTGCCTGCGCCGGCGCCGG - Intergenic
1160768874 19:821649-821671 CGCCCCTCCCCCGCCGGCGCCGG - Intronic
1160822593 19:1065436-1065458 GGGCCTCCCCGCGGCCCCGCAGG - Exonic
1160830789 19:1104186-1104208 CTGCCTCCGCTCGCCGGCGTGGG + Intronic
1160967546 19:1753304-1753326 CGGCCTGCCCCAGCGGGCGCGGG + Exonic
1161267167 19:3369716-3369738 CGGCCTCCCCGCGCCTGCTCTGG + Intronic
1161345923 19:3768658-3768680 CGGCCTCCCTGGGCAGGCGGGGG + Intergenic
1161604671 19:5208039-5208061 CGTCCTGCCCACGCCGGCACTGG + Exonic
1161703027 19:5805236-5805258 CGGCCATCCCGGGCCGGCGGGGG - Intergenic
1161773350 19:6243245-6243267 CGGCCTCCCCGAGCCTTCCCGGG - Intronic
1161966134 19:7550230-7550252 TGGCCTCCCAGCGCCGGTGTAGG + Intronic
1162033199 19:7926041-7926063 CGGCCTCTCCCCGGCGGCGGCGG + Exonic
1162584689 19:11551735-11551757 TAGCTTCCCCGCGCCGGCCCAGG - Intronic
1162643981 19:12035437-12035459 GGGCCTCCCCGCGGCGACTCCGG - Intronic
1162651557 19:12092551-12092573 GGGCCTCCCCGCGGCGACTCCGG + Intronic
1162778703 19:12995786-12995808 GGGCCTCCCCTCGCCGCGGCCGG + Exonic
1162975688 19:14206230-14206252 CGGCCCCCTCGCGGCGGCGGAGG + Intergenic
1163509706 19:17727355-17727377 CGGCCTCCCCGCCCCGCAGTGGG - Exonic
1163513053 19:17747647-17747669 CTGCCTCCTGGCGCCGTCGCGGG + Intergenic
1163597078 19:18226388-18226410 GGGCCCCCCCGCGCCCGCCCCGG - Intronic
1163844129 19:19628852-19628874 CGGCCTCCCTGCGGCGGCCCCGG + Exonic
1164051153 19:21586628-21586650 CGGACCCTCCGCGCCGGGGCGGG + Intergenic
1165420198 19:35718452-35718474 CGGCCTGCCCACGCCGCCCCCGG - Intronic
1165448311 19:35868770-35868792 CGGCCTCACCTCGGCCGCGCCGG - Exonic
1165879466 19:39032173-39032195 CCGGGTCCCCGCGCCGGAGCCGG - Exonic
1166304093 19:41928000-41928022 CCCCCTCCCCGCCCCTGCGCCGG + Intronic
1166641936 19:44500730-44500752 CGGCCTCCCGGCGCCGCGGCTGG - Intergenic
1166938059 19:46346952-46346974 CGCCCTTCACGCGCCTGCGCAGG - Intergenic
1167619250 19:50551939-50551961 AGGCCTCCCCCAGGCGGCGCAGG - Intronic
1167643972 19:50695865-50695887 CCCCCTCCCCGCGCTGGCTCGGG - Intronic
1167648605 19:50718477-50718499 CAGCCCCCCCGGGCCGGCTCCGG + Intronic
1167738815 19:51312013-51312035 CTGCATCCCTGGGCCGGCGCGGG + Intronic
1167738819 19:51312020-51312042 GGGCCTCCCCGCGCCGGCCCAGG - Intronic
1167738870 19:51312138-51312160 CGGCGTCCTCGGGCCGGAGCCGG + Intronic
1168336286 19:55599416-55599438 CGGCCTCCCGGGGCCGCCCCGGG - Intronic
1168718987 19:58544642-58544664 CGGCCTCGCGGCGGCGGCGGCGG + Exonic
1202647692 1_KI270706v1_random:157312-157334 GGGCCTCTCTGCGCCTGCGCCGG - Intergenic
925730636 2:6917664-6917686 CGCCCTCCCCGCTCCGCGGCCGG - Intronic
925928206 2:8685450-8685472 CGACCGCCCCGCGCTGGCCCCGG - Intergenic
926155101 2:10448985-10449007 CCGCCTCCACGCCCCCGCGCTGG + Intergenic
926801845 2:16665930-16665952 CAGCCGCCCCGCCCCGGCCCCGG + Intronic
929188557 2:39120280-39120302 CAGCCCCCCAGCGCGGGCGCTGG - Intronic
930011446 2:46941140-46941162 AGGCCTCCCCACGCCCCCGCGGG + Intronic
931515788 2:63050260-63050282 CGGGCTGCTCGTGCCGGCGCAGG - Intronic
932446662 2:71785851-71785873 CCTCCTCCCCGCGGCCGCGCAGG - Intergenic
933782346 2:85811306-85811328 CGGCCTCCCCCCGCCCCCGCAGG + Intergenic
934098232 2:88627151-88627173 TGGCCTCCCAGCGCCGACGGCGG - Exonic
934566933 2:95346468-95346490 CGCCCTTCCCGGGCAGGCGCGGG + Intronic
934566940 2:95346475-95346497 CGGCCCCCCCGCGCCTGCCCGGG - Intronic
936569404 2:113602184-113602206 GCGCCTCTCTGCGCCGGCGCCGG + Intergenic
936671518 2:114662318-114662340 GGGCCTCCCTGCGGGGGCGCGGG + Intronic
937221308 2:120344568-120344590 CCGCCTCCCCGCCGCCGCGCAGG - Intergenic
937283635 2:120736601-120736623 CGGCCTCCGCGCGCCGGCGGGGG + Intronic
938496931 2:131802629-131802651 GCGCCTCTCCGCGCCTGCGCCGG + Intergenic
938496939 2:131802642-131802664 AGGCCCCCCAGCGCCGGCGCAGG - Intergenic
941819139 2:169827558-169827580 CGAGCTGCCCGCGCCGGGGCTGG + Exonic
942346112 2:175004854-175004876 CGGCCCACCTGCGGCGGCGCGGG + Intronic
942346116 2:175004861-175004883 CCGTCTCCCCGCGCCGCCGCAGG - Intronic
944412828 2:199459232-199459254 CGGCCTCCCCGCCCGGGGGGAGG + Intronic
947506786 2:230713445-230713467 CGGGCGCCCCACGCCGGCGAAGG - Intronic
947641707 2:231710690-231710712 CGGCCTCCCCGCGGCGGCTAGGG - Intronic
947765270 2:232633740-232633762 CGGCCTCCTCGCGCCGCAGCCGG - Exonic
948115728 2:235493712-235493734 CGGCCCCCGCGCCCCGGCACGGG - Intergenic
948196656 2:236101786-236101808 CGGCCTCACCCCGCTGGCTCGGG + Intronic
948487195 2:238288553-238288575 CGGGGTCCCAGCGCCGGCTCGGG - Exonic
948492095 2:238320394-238320416 CCGCCTTCCAGCGCCCGCGCAGG - Intergenic
948991745 2:241559098-241559120 GGCCCTCCCCGCCCCGGCCCGGG - Intronic
1169073824 20:2749795-2749817 GGCCCTCCCCTCGCCGGTGCGGG + Intronic
1171848038 20:30289796-30289818 CCGCCTCTCTTCGCCGGCGCTGG - Intergenic
1171972544 20:31573210-31573232 CGGCCCCCGCGGGGCGGCGCGGG - Intronic
1172277202 20:33686216-33686238 CGGCCCATGCGCGCCGGCGCTGG - Exonic
1172474437 20:35226629-35226651 CGGCCGCCCCCCACCGGGGCGGG + Intergenic
1173672860 20:44810266-44810288 CTCCATGCCCGCGCCGGCGCCGG + Exonic
1175267146 20:57709786-57709808 CGGCCTCCCCTCGGCAGCCCCGG + Exonic
1175394791 20:58650691-58650713 CAGCCTGGCCGCGCCGCCGCTGG - Intergenic
1175428888 20:58889282-58889304 CCGCCGCCCCGCGCCGGGACAGG - Intronic
1175562316 20:59940460-59940482 GGGCGTCCCCGCGCGGGCGCCGG + Intronic
1175922344 20:62456058-62456080 CGGCCTCCGCGGGGCGGCTCTGG + Intergenic
1176016624 20:62937405-62937427 CGGAGTCCCGGCGGCGGCGCGGG - Intronic
1176281498 20:64316392-64316414 CGGCCTCCACGGGCCGCAGCCGG - Intergenic
1176385946 21:6138598-6138620 CGGCCCCCTCTCGCCGGCTCCGG - Intergenic
1176604160 21:8815419-8815441 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1176619133 21:9043088-9043110 GGGCCTCCCTGCGCCTGCGCCGG + Intergenic
1178714333 21:34949664-34949686 CAGCCTGCCCTCGCTGGCGCGGG - Intronic
1179737527 21:43399654-43399676 CGGCCCCCTCTCGCCGGCTCCGG + Intergenic
1179783932 21:43719269-43719291 GGGCCTGGCCGCGGCGGCGCGGG - Exonic
1180093102 21:45542579-45542601 CCGTCTCCCAGCCCCGGCGCCGG + Intronic
1180346439 22:11706968-11706990 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180346445 22:11706997-11707019 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180346451 22:11707026-11707048 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180354208 22:11825121-11825143 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180354214 22:11825150-11825172 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180354220 22:11825179-11825201 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180384038 22:12167205-12167227 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
1180455379 22:15510210-15510232 CCCCCTGCCAGCGCCGGCGCAGG + Intergenic
1180699718 22:17774559-17774581 CGGGGAGCCCGCGCCGGCGCGGG + Intronic
1180699720 22:17774566-17774588 CCACAGCCCCGCGCCGGCGCGGG - Intronic
1180871740 22:19150429-19150451 CTGCCTCCGCGCGCGGGGGCCGG + Intergenic
1181162100 22:20965264-20965286 CCGCCTCTTCGCCCCGGCGCCGG + Intronic
1182771806 22:32801771-32801793 CGGCCTCCCGGCGAAGGAGCAGG - Exonic
1183058701 22:35322338-35322360 CGGCCTCCCTGCCCCCGCGGAGG - Intronic
1183452785 22:37906014-37906036 CGCCCGCCCCTCGACGGCGCCGG - Intronic
1183976849 22:41517335-41517357 TGGCCTCCCCTCACCGGCCCAGG + Intronic
1183978964 22:41528619-41528641 GTGCCTCCCCGCCCCGCCGCTGG + Exonic
1184337554 22:43862625-43862647 CGTCCTCCCCGCCCCGCCCCCGG + Intergenic
1184439085 22:44497927-44497949 CGCCCGCCCCGCGCCCGCCCGGG + Intronic
1184664259 22:45978959-45978981 CGGCCTCCCTGCGGCGGGTCTGG + Intergenic
949089560 3:11418-11440 CGCCCTCTCTGCGCCTGCGCCGG - Intergenic
950345347 3:12287893-12287915 CCGCCTGCCCGCGGCGGAGCCGG - Intronic
952301278 3:32106566-32106588 CGGCCACCCCCGCCCGGCGCCGG - Exonic
952354296 3:32570484-32570506 CGGCCTCGGCGCGCCGGGGATGG + Intronic
953598349 3:44338533-44338555 CACCCTCCCCGCTCCGGCGGCGG - Exonic
953748715 3:45594080-45594102 CGCCCCCTCCGCCCCGGCGCGGG + Intronic
954277971 3:49554688-49554710 CGGCTTTCCTGCGCCGGGGCCGG - Exonic
958732287 3:97972339-97972361 GGGCATCCCAGCGCCGGGGCAGG - Exonic
960937618 3:122913141-122913163 CGCCCTCACCGCTCCGGGGCTGG + Intronic
961539437 3:127590073-127590095 CCGCCACCCCGCGCCGGACCGGG + Intronic
961827332 3:129606032-129606054 CTGCCTCCCGCCGCGGGCGCGGG - Exonic
963827443 3:149970671-149970693 CGGCCACCCCGCTCCGGTGCAGG + Intronic
964438081 3:156674856-156674878 CGGCCTCGCGGCTCCGGCCCCGG + Exonic
965757415 3:172040309-172040331 CCGCCTCTCCGCGCCGGCGGGGG + Intronic
966592295 3:181696162-181696184 CGGCCTCCCAGAGCCCGCACCGG + Intergenic
966592300 3:181696169-181696191 CGGCCTCCCGGTGCGGGCTCTGG - Intergenic
966684828 3:182682730-182682752 CGCCCCCCGCGCGCCGGCCCGGG + Intergenic
966852742 3:184174831-184174853 CCGCCGCCCCGCCCCGGCCCCGG - Intronic
968225481 3:196969666-196969688 CGGCCTCGCCGTGCCGACCCCGG - Intergenic
968674798 4:1871584-1871606 CGGCCTCCCGGCCCCAGCCCCGG - Intronic
968756413 4:2418428-2418450 CAGCCTCCCTGCGACAGCGCGGG - Exonic
969146653 4:5130161-5130183 AGGCCTCCCCCCGCCGGAGAAGG - Intronic
969330672 4:6472106-6472128 CGGCATCCCCACGCCGCGGCCGG + Intronic
969671515 4:8592727-8592749 CGCCCTCCCTGCGCCGGGGGCGG + Exonic
973373962 4:49275530-49275552 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
973383450 4:49334709-49334731 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
973387057 4:49519723-49519745 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
973387063 4:49519752-49519774 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
975342573 4:73258566-73258588 GGGCCCCCCCGCGGCGGCGGAGG - Exonic
975612182 4:76213889-76213911 CCGCCTCCCCGCGCAGTCGCCGG - Exonic
978340879 4:107720272-107720294 GGGCCTCCTCGCGTCGGAGCGGG + Exonic
979523840 4:121697098-121697120 CGGCCTCAGCGCGCCTGCGTGGG + Exonic
981067198 4:140497988-140498010 GGGCCTCCCAGTGCCAGCGCGGG + Intronic
982584863 4:157222874-157222896 CTGCCTGCCCACGCCTGCGCGGG - Intronic
986330667 5:6714106-6714128 CTGCCTCAACTCGCCGGCGCTGG + Intergenic
990381234 5:55223442-55223464 CGGCGGCCCTGCGCCGGCTCCGG + Intronic
990381237 5:55223449-55223471 CGGCTGCCCGGAGCCGGCGCAGG - Intronic
990382919 5:55233467-55233489 CCGCCTCCCCGCTCGGGCGGCGG + Exonic
992105287 5:73444941-73444963 CGGACTCCACGCGCCGCCCCGGG - Intronic
995831596 5:116361150-116361172 AGGCTTCCCTGCGCCGGCTCTGG - Intronic
996298573 5:121954216-121954238 CGGCCGGCCCGCGCCCGCGCCGG - Intergenic
998130411 5:139648796-139648818 CGGCCTCGCGGCGACGGCGGCGG + Exonic
999727053 5:154446129-154446151 CGGCCTCCTCGCGCGGGGCCCGG - Exonic
1001653186 5:173329561-173329583 CGTCTCCCCCGCGCCGGGGCCGG + Intergenic
1002184232 5:177446868-177446890 CCGCCTCCCCCCGCAGGCCCGGG + Exonic
1002754696 6:148150-148172 AAGGCACCCCGCGCCGGCGCGGG + Intergenic
1002754698 6:148157-148179 GTGCGTGCCCGCGCCGGCGCGGG - Intergenic
1006642462 6:35496411-35496433 CGGCCTCCCAGCGCCCAGGCCGG - Intronic
1011044372 6:83065812-83065834 CGGCAGCCCCGCTGCGGCGCAGG + Exonic
1013106138 6:107028163-107028185 CGCTCTCACTGCGCCGGCGCCGG + Intergenic
1013117870 6:107115801-107115823 CGGTCTTCCCGCGCCGCCACCGG + Intergenic
1014755879 6:125301762-125301784 CGGCCTCCCCGCTCGGCCGGCGG - Intronic
1017731816 6:157323644-157323666 CGTCTTCCCGGCCCCGGCGCGGG - Intergenic
1019343622 7:519630-519652 CGCCCTCCGCTCGCCGGGGCCGG + Intronic
1019663905 7:2241936-2241958 CGGCCTCCCCACGGCCCCGCCGG + Intronic
1020238474 7:6374481-6374503 CGGCCTCCCCTCCCCCGCGCCGG - Intergenic
1020785805 7:12571019-12571041 CGCCCTCCCCTCGCCGGCCTTGG - Intronic
1023773746 7:43583520-43583542 CAGCCTCGCCGCCGCGGCGCCGG - Intronic
1025089670 7:56051787-56051809 CGGCCACGCCGCGCCGGCTCTGG + Exonic
1026909472 7:74083901-74083923 CCGCCTCCCCGGGCCGGCGGCGG + Intronic
1027232625 7:76281628-76281650 CGGCGTCCGCGCCCCGCCGCAGG + Exonic
1027592754 7:80135477-80135499 AGGACTCCCCGCGGCGGGGCGGG + Intronic
1028871146 7:95772725-95772747 TGGGCTCCCCGAGCCGGCGGCGG - Exonic
1029432407 7:100539611-100539633 CGGCCTCCCCACCCCGCCCCCGG - Intronic
1029543475 7:101198300-101198322 CGGCCTGCCCGAGCTGGGGCTGG + Exonic
1030049041 7:105522020-105522042 CGGCCTCCCCGCGGCCGCCGGGG - Intronic
1030714231 7:112790045-112790067 CGGCCTCCCAGGGCCGGGGTAGG - Intronic
1031887007 7:127253426-127253448 GCGCCTCCCCGCGCCGGTCCCGG - Intergenic
1032125190 7:129188586-129188608 CGGCCCCCCTGCGCCGAGGCTGG - Intergenic
1033253169 7:139777767-139777789 CCGCCTCCCGTGGCCGGCGCCGG + Intronic
1035496818 7:159335248-159335270 AAGGCGCCCCGCGCCGGCGCGGG - Intergenic
1035747545 8:1973483-1973505 CGGCCCCCGCGCGTGGGCGCGGG + Intergenic
1036827137 8:11986320-11986342 CACCCTCCCCGCCCCGGCCCTGG - Intergenic
1037882323 8:22579254-22579276 CGGCCCGCCCTCCCCGGCGCCGG + Exonic
1038152660 8:24956539-24956561 CGGGCTCCCACCGCCGCCGCGGG - Exonic
1041511637 8:58659763-58659785 CGGCCGCCCAGCGGCGCCGCAGG - Intronic
1044698842 8:94948983-94949005 CTGCCTCCCCTCGCCGCCGCCGG - Intronic
1044988657 8:97776273-97776295 TGGCCTCCCCCAGTCGGCGCTGG - Intronic
1045098854 8:98825733-98825755 CGGCCGCCCCGCCCCGCCCCCGG + Intronic
1045098866 8:98825753-98825775 CGGCCGCCCCGCCCCGCCCCCGG + Intronic
1045098878 8:98825773-98825795 CGGCCGCCCCGCCCCGCCCCCGG + Intronic
1045098890 8:98825793-98825815 CGGCCGCCCCGCCCCGCCCCCGG + Intronic
1045098902 8:98825813-98825835 CGGCCGCCCCGCCCCGCCCCCGG + Intronic
1045098914 8:98825833-98825855 CGGCCGCCCCGCCCCGCCCCCGG + Intronic
1045098926 8:98825853-98825875 CGGCCGCCCCGCCCCGCCCCCGG + Intronic
1049628189 8:143636123-143636145 CGTCCTCTCCCCGCCCGCGCCGG + Intronic
1049756633 8:144313791-144313813 CCGCCTCCCCGCCCCGCCCCCGG + Intronic
1049936315 9:504598-504620 CGGCTTCCCCGCCCCGGCGGCGG + Intronic
1050874018 9:10613102-10613124 CGGCCCCCGCCCGCCGGAGCGGG - Intergenic
1052837742 9:33264465-33264487 CGGCCTGCGAGCGCCGGCGGCGG + Exonic
1052970243 9:34372893-34372915 AGGCCTACCCCCGCCGCCGCCGG - Exonic
1053239789 9:36486945-36486967 GGGCCACCCTGGGCCGGCGCGGG - Intronic
1053435016 9:38068738-38068760 CGGACGCCCCCCGCCGGGGCCGG - Exonic
1053752905 9:41274031-41274053 CGCCCCCTCCGCGCCTGCGCCGG + Intergenic
1054333338 9:63781661-63781683 CGCCCCCTCCGCGCCTGCGCCGG - Intergenic
1054350964 9:64016540-64016562 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054350970 9:64016569-64016591 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351018 9:64016801-64016823 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351024 9:64016830-64016852 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351030 9:64016859-64016881 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351036 9:64016888-64016910 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351042 9:64016917-64016939 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351048 9:64016946-64016968 GGGCCTCTCTGCGCCTGCGCCGG + Intergenic
1054351050 9:64016959-64016981 AGGGCTCACAGCGCCGGCGCAGG - Intergenic
1057752464 9:97803676-97803698 CGCCCTCCCGCCGCCGGGGCTGG - Intergenic
1060700953 9:125748058-125748080 CGGCCACCCGGGCCCGGCGCGGG + Intronic
1060770142 9:126326710-126326732 GGGCCTCCCGGCGCTGGCGCTGG - Intergenic
1061365903 9:130172422-130172444 CGGCCACACCGCGCCGGCGCCGG + Intergenic
1061882173 9:133573984-133574006 CGGCCTCCCCGCGCCTCACCTGG - Exonic
1061975947 9:134068106-134068128 CGGCCTCCCCTGGGCGGCCCCGG - Intronic
1062083131 9:134634925-134634947 CAGCCTCCCCACGCTGGCTCAGG - Intergenic
1062162342 9:135087420-135087442 TGGAGTCCCCGCGCCGCCGCCGG + Intronic
1062346723 9:136118489-136118511 TGCCCTCTCCGCGGCGGCGCCGG + Exonic
1062363700 9:136199127-136199149 CGACGTCCCCGCGCCGGCCGGGG - Intronic
1062389229 9:136327466-136327488 CCCCCTCCCCGCGCGGGCGGCGG + Exonic
1062574577 9:137200262-137200284 CCGCCGCGCCGCGCCGCCGCGGG - Exonic
1062600321 9:137316307-137316329 CGGCCTTCGCGCGCCGGCCTGGG + Intronic
1202800343 9_KI270719v1_random:169985-170007 CGCCCCCTCCGCGCCTGCGCCGG - Intergenic
1202800350 9_KI270719v1_random:170015-170037 GCGCCTCTCCGCGCCTGCGCCGG - Intergenic
1203788400 EBV:140819-140841 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788444 EBV:140921-140943 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788488 EBV:141023-141045 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788532 EBV:141125-141147 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788576 EBV:141227-141249 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788620 EBV:141329-141351 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788664 EBV:141431-141453 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788708 EBV:141533-141555 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788752 EBV:141635-141657 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788796 EBV:141737-141759 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788840 EBV:141839-141861 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788884 EBV:141941-141963 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788928 EBV:142043-142065 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203788972 EBV:142145-142167 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203789016 EBV:142247-142269 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203789060 EBV:142349-142371 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203789104 EBV:142451-142473 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203789148 EBV:142553-142575 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203789192 EBV:142655-142677 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203789236 EBV:142757-142779 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203789280 EBV:142859-142881 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203789324 EBV:142961-142983 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203789368 EBV:143063-143085 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203789412 EBV:143165-143187 CGGCCACCCCCCGCCGGAGCGGG - Intergenic
1203551562 Un_KI270743v1:167545-167567 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1189114284 X:38327307-38327329 CGGCCTTCCGCCACCGGCGCGGG + Intronic
1189114306 X:38327388-38327410 CAGCCTCCTGGCCCCGGCGCAGG - Exonic
1189323233 X:40098339-40098361 CGGCCTCCCCTCCCCAGCTCGGG + Intronic
1190041856 X:47078391-47078413 CGGCCTCCCCGCCCCCTCCCTGG + Exonic
1190056869 X:47186206-47186228 CGGCCTGCCGGCCCCGGCCCCGG - Intronic
1190117870 X:47637786-47637808 CGGCCTCCAGGCTCCGGGGCCGG - Exonic
1197709341 X:129654650-129654672 CGGCCCCGGCGAGCCGGCGCGGG + Exonic
1200093870 X:153648211-153648233 CGGCCTCCCCGCGCCGGCGCCGG - Exonic
1201152840 Y:11103180-11103202 GGGCCCCCCTGCGCCTGCGCCGG + Intergenic