ID: 1200094514

View in Genome Browser
Species Human (GRCh38)
Location X:153650876-153650898
Sequence GATCCCGTCAAGACATCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 38}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200094514_1200094524 19 Left 1200094514 X:153650876-153650898 CCCCCAGATGTCTTGACGGGATC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1200094524 X:153650918-153650940 GAGGGTGGCCAAACTACCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 41
1200094514_1200094527 28 Left 1200094514 X:153650876-153650898 CCCCCAGATGTCTTGACGGGATC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1200094527 X:153650927-153650949 CAAACTACCGCCGGAGGAGATGG 0: 1
1: 0
2: 0
3: 4
4: 50
1200094514_1200094529 30 Left 1200094514 X:153650876-153650898 CCCCCAGATGTCTTGACGGGATC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1200094529 X:153650929-153650951 AACTACCGCCGGAGGAGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1200094514_1200094523 4 Left 1200094514 X:153650876-153650898 CCCCCAGATGTCTTGACGGGATC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1200094523 X:153650903-153650925 GGGCTCTTTGTGAGTGAGGGTGG 0: 1
1: 1
2: 2
3: 28
4: 214
1200094514_1200094525 22 Left 1200094514 X:153650876-153650898 CCCCCAGATGTCTTGACGGGATC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1200094525 X:153650921-153650943 GGTGGCCAAACTACCGCCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
1200094514_1200094521 0 Left 1200094514 X:153650876-153650898 CCCCCAGATGTCTTGACGGGATC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1200094521 X:153650899-153650921 ACTGGGGCTCTTTGTGAGTGAGG 0: 1
1: 0
2: 6
3: 21
4: 260
1200094514_1200094528 29 Left 1200094514 X:153650876-153650898 CCCCCAGATGTCTTGACGGGATC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1200094514_1200094522 1 Left 1200094514 X:153650876-153650898 CCCCCAGATGTCTTGACGGGATC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1200094522 X:153650900-153650922 CTGGGGCTCTTTGTGAGTGAGGG 0: 1
1: 0
2: 7
3: 67
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200094514 Original CRISPR GATCCCGTCAAGACATCTGG GGG (reversed) Exonic
902087385 1:13874014-13874036 GCTCCAGTCAAGCCGTCTGGGGG - Intergenic
903285256 1:22272945-22272967 AATCCCGTCAGGATAGCTGGAGG + Intergenic
913281121 1:117185954-117185976 CATACCGTCAAGACCTCTGGAGG + Intronic
923698686 1:236280505-236280527 GATCCAATCAATACATGTGGAGG + Intronic
924550818 1:245075230-245075252 GATCCCGTCAAAACACCTGCCGG + Intronic
924865835 1:247978967-247978989 GATCCTGTAAACACATGTGGGGG - Intronic
924868461 1:248012391-248012413 GATCCTGTAAACACATGTGGGGG - Intronic
1085200594 11:74699554-74699576 GATACCATCAAGCCATCAGGAGG + Intronic
1085867252 11:80308857-80308879 GAACCCCTGAAGACATCAGGAGG + Intergenic
1095126683 12:38487443-38487465 AATCCAGGCAAGACGTCTGGTGG - Intergenic
1104153711 12:126109981-126110003 GATCTCGGCAGGACCTCTGGAGG - Intergenic
1124887034 15:33696750-33696772 GAGCCCATGAAAACATCTGGAGG + Intronic
1133249875 16:4474151-4474173 AATCCGGTCCAGAGATCTGGGGG + Exonic
1134598934 16:15518337-15518359 CATTCCAGCAAGACATCTGGGGG - Intronic
1136062344 16:27735254-27735276 GTTCCCACCAAGACGTCTGGCGG - Intronic
1144632370 17:16880743-16880765 GGTCCCATCAAGGCCTCTGGAGG - Intergenic
1144638087 17:16923676-16923698 GGTCCCATCAAGGCCTCTGGAGG - Intergenic
937270078 2:120644034-120644056 GATTCCGTTCACACATCTGGTGG + Intergenic
941532268 2:166685290-166685312 GAACCCTTCAAGAAATCTTGTGG + Intergenic
944333537 2:198501698-198501720 GATCAGGTCAGGACATCTGCTGG + Intronic
1174933345 20:54840665-54840687 GATGCTGTCAACACAACTGGGGG - Intergenic
1182902217 22:33907956-33907978 GATGCCTTCAGGAAATCTGGTGG - Intronic
1185376143 22:50483438-50483460 GGTCCCTTCATGACCTCTGGAGG - Exonic
950036709 3:9891013-9891035 GATCCCCTCAAGGCACCGGGCGG - Intronic
954520479 3:51221122-51221144 TATCCCGTTAAGATTTCTGGTGG + Intronic
954564637 3:51588908-51588930 GAAGCCGTAAAGACATCTTGAGG - Intronic
986126047 5:4883110-4883132 GACCCCGTGAAGACATTGGGAGG - Intergenic
999128780 5:149266713-149266735 GGACCCATGAAGACATCTGGAGG - Intergenic
1003292758 6:4793978-4794000 GATCCCTTTTAGACATCTAGTGG + Intronic
1008065162 6:47040017-47040039 TATCCAGTCAAGAAATCTGAAGG + Intronic
1011978871 6:93345877-93345899 GATCCAGACAAGCAATCTGGTGG - Intronic
1017769926 6:157637140-157637162 GATCCCATCAGCACATCTGTTGG + Intronic
1018031417 6:159844799-159844821 GATCCAGTCAATACAGCTGTGGG - Intergenic
1029335637 7:99897137-99897159 GACCCCGTGAAGAGATCTAGTGG + Intronic
1060283181 9:122227424-122227446 GGTCCCTTCAAGACAGCGGGTGG + Exonic
1187493868 X:19777630-19777652 GAGCCCGTCCAGACTTCTAGGGG - Intronic
1187972805 X:24675307-24675329 GATCCAGTGAATAAATCTGGAGG - Intergenic
1189356214 X:40311757-40311779 GACAGAGTCAAGACATCTGGGGG - Intergenic
1200094506 X:153650826-153650848 GTTCCCGGCCACACATCTGGTGG + Exonic
1200094514 X:153650876-153650898 GATCCCGTCAAGACATCTGGGGG - Exonic
1200428158 Y:3045451-3045473 ACTCCCGTCAAAATATCTGGGGG - Intergenic