ID: 1200094515

View in Genome Browser
Species Human (GRCh38)
Location X:153650877-153650899
Sequence TGATCCCGTCAAGACATCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 58}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200094515_1200094521 -1 Left 1200094515 X:153650877-153650899 CCCCAGATGTCTTGACGGGATCA 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1200094521 X:153650899-153650921 ACTGGGGCTCTTTGTGAGTGAGG 0: 1
1: 0
2: 6
3: 21
4: 260
1200094515_1200094527 27 Left 1200094515 X:153650877-153650899 CCCCAGATGTCTTGACGGGATCA 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1200094527 X:153650927-153650949 CAAACTACCGCCGGAGGAGATGG 0: 1
1: 0
2: 0
3: 4
4: 50
1200094515_1200094522 0 Left 1200094515 X:153650877-153650899 CCCCAGATGTCTTGACGGGATCA 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1200094522 X:153650900-153650922 CTGGGGCTCTTTGTGAGTGAGGG 0: 1
1: 0
2: 7
3: 67
4: 288
1200094515_1200094529 29 Left 1200094515 X:153650877-153650899 CCCCAGATGTCTTGACGGGATCA 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1200094529 X:153650929-153650951 AACTACCGCCGGAGGAGATGGGG 0: 1
1: 0
2: 0
3: 1
4: 51
1200094515_1200094524 18 Left 1200094515 X:153650877-153650899 CCCCAGATGTCTTGACGGGATCA 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1200094524 X:153650918-153650940 GAGGGTGGCCAAACTACCGCCGG 0: 1
1: 0
2: 0
3: 2
4: 41
1200094515_1200094528 28 Left 1200094515 X:153650877-153650899 CCCCAGATGTCTTGACGGGATCA 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1200094515_1200094525 21 Left 1200094515 X:153650877-153650899 CCCCAGATGTCTTGACGGGATCA 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1200094525 X:153650921-153650943 GGTGGCCAAACTACCGCCGGAGG 0: 1
1: 0
2: 0
3: 3
4: 50
1200094515_1200094523 3 Left 1200094515 X:153650877-153650899 CCCCAGATGTCTTGACGGGATCA 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1200094523 X:153650903-153650925 GGGCTCTTTGTGAGTGAGGGTGG 0: 1
1: 1
2: 2
3: 28
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200094515 Original CRISPR TGATCCCGTCAAGACATCTG GGG (reversed) Exonic
904479996 1:30787646-30787668 TGATCCTGAGAAGACATATGAGG - Intergenic
906474146 1:46156536-46156558 TTATCCAGAGAAGACATCTGTGG + Intronic
1063406274 10:5798614-5798636 TGACTCCCTCAATACATCTGGGG + Intronic
1072619293 10:97068892-97068914 TGAGCCTCTCAAGACATATGGGG - Intronic
1073656161 10:105419247-105419269 TTATCCCATTAAGACATATGGGG - Intergenic
1080048350 11:27833342-27833364 TGATCCAGTCAAGATATCTGGGG - Intergenic
1080231657 11:30022951-30022973 GGATCACGTTTAGACATCTGGGG - Intergenic
1089220359 11:116865878-116865900 TGATCCCATCAAGACATGCTGGG + Intronic
1090371590 11:126258448-126258470 TGATTCAGTTAAGAAATCTGGGG - Intronic
1090630223 11:128639680-128639702 TGGTCTCTTGAAGACATCTGTGG - Intergenic
1091758234 12:3070003-3070025 TCACCCCCACAAGACATCTGAGG + Intergenic
1098973989 12:76883312-76883334 GGATCCAGTCAAGGCATTTGAGG + Intergenic
1100198935 12:92278045-92278067 TGATCCAGTTCAGACATCTTGGG - Intergenic
1100219510 12:92489195-92489217 TGAACCCGTTATGACATTTGAGG - Intergenic
1104209320 12:126672032-126672054 TGATCAAGTCAGGATATCTGGGG + Intergenic
1108105844 13:47008201-47008223 TGCTTCTATCAAGACATCTGGGG + Intergenic
1108209178 13:48121074-48121096 TCATCCCCTCAAAACATTTGTGG + Intergenic
1111092901 13:83470679-83470701 TAGTCCAGTCAAGACATATGAGG - Intergenic
1113916282 13:113875893-113875915 AGATCCAGCCAAGCCATCTGGGG - Intergenic
1120334790 14:83141061-83141083 TCTTCCCCTCAAGACATCAGAGG - Intergenic
1122016705 14:98802661-98802683 TGATCTGGTCAAGAAATCTCTGG - Intergenic
1122064279 14:99160595-99160617 TGATCCTCTCAAGACCTCTGTGG + Intergenic
1125315444 15:38426466-38426488 TGATCCAGTCAGGGTATCTGGGG - Intergenic
1130449550 15:84037017-84037039 TGATGCCATCAAGGCCTCTGGGG - Intronic
1132387889 15:101413740-101413762 TGATCAAGTCAAGGCATTTGGGG - Intronic
1139139769 16:64247231-64247253 TGATCATGTCAAGGCATTTGGGG - Intergenic
1142876613 17:2854908-2854930 TGATCCCGGCAACATCTCTGTGG - Intronic
1157009265 18:43627190-43627212 TGATTTAGTCAAGACATCAGAGG - Intergenic
1157299753 18:46471132-46471154 TGATGCCATGTAGACATCTGAGG - Intergenic
1158493637 18:57933140-57933162 TGAACCAGTCCAGATATCTGTGG + Intergenic
929957285 2:46467907-46467929 TAAACACTTCAAGACATCTGAGG + Intronic
933984394 2:87578504-87578526 TGATTCCCTCAACACATCTGTGG + Intergenic
936309460 2:111372296-111372318 TGATTCCCTCAACACATCTGTGG - Intergenic
938103048 2:128511468-128511490 TGCTGCCGCCAAGACCTCTGGGG + Intergenic
943883089 2:193172335-193172357 TGAAACCGTCAAGACTTCAGTGG + Intergenic
944222987 2:197320829-197320851 TGATACCCCTAAGACATCTGTGG - Intergenic
948387222 2:237588482-237588504 TGATCCGCTCAAGTCAGCTGGGG + Intronic
1174933346 20:54840666-54840688 TGATGCTGTCAACACAACTGGGG - Intergenic
1177706573 21:24713931-24713953 TGTTCCAGTCATGTCATCTGGGG + Intergenic
1177888047 21:26770169-26770191 TGAACCTGTCAAGACAACTAGGG - Intergenic
1179196268 21:39165566-39165588 TGATCCAGTCAGGATATCTGAGG + Intergenic
1182090045 22:27588378-27588400 TGATACAGTCAAGACCTCTCAGG + Intergenic
949517893 3:4823803-4823825 TGATCCAGTCAAGGTATCTAGGG - Intronic
966805193 3:183802163-183802185 TGATTCTGTCAAAACAACTGGGG - Intronic
973596447 4:52495711-52495733 TGATCAAGTCAAGGCATTTGAGG - Intergenic
974391548 4:61276550-61276572 TGATTCCTTAAACACATCTGCGG - Intronic
982096169 4:151925542-151925564 AGATCCCATCTAGATATCTGGGG + Intergenic
989239677 5:39189529-39189551 TGAACCCTTCAACACAGCTGTGG - Intronic
996538340 5:124602052-124602074 TAGTGCCGTCAAGCCATCTGTGG - Intergenic
996664595 5:126043893-126043915 TGATCCCCCAAAGACAGCTGAGG - Intergenic
996872638 5:128208712-128208734 TGCTCCCATCAAGAGTTCTGTGG + Intergenic
1013298174 6:108778633-108778655 TGAATCCATCAACACATCTGAGG - Intergenic
1018031418 6:159844800-159844822 TGATCCAGTCAATACAGCTGTGG - Intergenic
1020158346 7:5746560-5746582 TGACTCAGTCAAGACACCTGAGG - Intronic
1022175904 7:27871444-27871466 TTATCCCATTAGGACATCTGTGG - Intronic
1025113097 7:56235779-56235801 TGATCCCAGCTGGACATCTGAGG - Intergenic
1027913691 7:84286082-84286104 TGAACCTGTCAAGACTTCAGTGG - Intronic
1030868083 7:114723966-114723988 TGATCAAGTCAAGATATTTGGGG + Intergenic
1037509485 8:19567191-19567213 TGATCAGCTCAGGACATCTGGGG - Intronic
1039427183 8:37495552-37495574 TGATGCCCTCAAGAGATTTGTGG + Intergenic
1049543985 8:143221138-143221160 TGCTCCCGTAAAGAGAACTGTGG + Intergenic
1050181786 9:2930998-2931020 TGATTCTGTAAAGAAATCTGTGG + Intergenic
1059282539 9:113147426-113147448 GGAACCTGTCAAGACAACTGAGG + Intergenic
1187354602 X:18555244-18555266 TGCTCCCCCCAAGACATCTGGGG - Intronic
1189356215 X:40311758-40311780 TGACAGAGTCAAGACATCTGGGG - Intergenic
1200094515 X:153650877-153650899 TGATCCCGTCAAGACATCTGGGG - Exonic