ID: 1200094528

View in Genome Browser
Species Human (GRCh38)
Location X:153650928-153650950
Sequence AAACTACCGCCGGAGGAGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200094514_1200094528 29 Left 1200094514 X:153650876-153650898 CCCCCAGATGTCTTGACGGGATC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1200094517_1200094528 26 Left 1200094517 X:153650879-153650901 CCAGATGTCTTGACGGGATCACT 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1200094516_1200094528 27 Left 1200094516 X:153650878-153650900 CCCAGATGTCTTGACGGGATCAC 0: 1
1: 0
2: 0
3: 9
4: 46
Right 1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1200094515_1200094528 28 Left 1200094515 X:153650877-153650899 CCCCAGATGTCTTGACGGGATCA 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200094528 Original CRISPR AAACTACCGCCGGAGGAGAT GGG Exonic
902499592 1:16900850-16900872 AAACTAACTCCTGAGAAGATAGG + Intronic
910812889 1:91255778-91255800 AAAATACCGCGGCAGGAGAATGG + Intergenic
911170224 1:94763653-94763675 AAACTACCGTCAGAGTAAATAGG + Intergenic
914227205 1:145730541-145730563 AAACTACTGCCCAAGGAGTTAGG + Intronic
920400129 1:205671030-205671052 AAACAAATGCCAGAGGAGATTGG + Intronic
1064991878 10:21263555-21263577 AAACTAACCCCCGGGGAGATAGG - Intergenic
1068017778 10:51539707-51539729 AATCTTCCACCAGAGGAGATAGG + Intronic
1071651229 10:87394727-87394749 AAACCACTGCCCTAGGAGATGGG - Intergenic
1072950952 10:99846332-99846354 AAACTACCCCCAGAGGAACTGGG - Intronic
1080800235 11:35603523-35603545 AAACTAGCGCTGGATGACATTGG + Intergenic
1083104682 11:60346416-60346438 AAACTACAGCAGCAGGTGATAGG - Intronic
1083434705 11:62634373-62634395 AAACTGGGGCAGGAGGAGATGGG + Exonic
1094701612 12:32875780-32875802 AGACTACAGCAGGAGGAGATGGG + Intronic
1094813709 12:34164655-34164677 AAAATGCAGCAGGAGGAGATGGG + Intergenic
1113787263 13:113009021-113009043 AGACGACCCCCAGAGGAGATTGG + Intronic
1114623866 14:24115734-24115756 AAGTTACCTGCGGAGGAGATAGG - Exonic
1129857120 15:78832305-78832327 AAACTGAAGCCAGAGGAGATGGG - Intronic
1143241215 17:5444727-5444749 AAACTACCGCCTGTGAAGGTAGG + Intronic
1143497678 17:7321708-7321730 ACACTAGCACCGGGGGAGATGGG - Exonic
1155086701 18:22466007-22466029 AAACTACCCCCAGAGAAGCTGGG - Intergenic
1165362144 19:35343407-35343429 AAAATACCCCTGGAGGAGATGGG - Intronic
926195130 2:10759100-10759122 TAAATGCCCCCGGAGGAGATAGG - Intronic
935756984 2:106283919-106283941 AAACTCCCACAGGAGGAGACAGG + Intergenic
936112580 2:109677117-109677139 AAACTCCCACAGGAGGAGACAGG - Intergenic
947562670 2:231171201-231171223 AAAATACTGTCGAAGGAGATGGG - Intronic
1177222681 21:18215305-18215327 AAACTTCCACCTCAGGAGATAGG + Intronic
1185384068 22:50523673-50523695 TTACTACGGCCGGAGCAGATCGG - Exonic
952472479 3:33671014-33671036 AAACTAGAGCAGCAGGAGATGGG - Intronic
962981305 3:140492878-140492900 AAACTGCCCCCGCAGGAGACAGG + Intronic
967675539 3:192294393-192294415 AAACTACCACCTTAGGAGTTAGG + Intronic
988101411 5:26683795-26683817 AAACTACTGCAGGAGGAAAAGGG + Intergenic
989468227 5:41782832-41782854 AAACTACAGACAGAAGAGATAGG + Intronic
991532196 5:67627908-67627930 AAACTACCACCAGAGGGAATAGG - Intergenic
995468347 5:112474345-112474367 AAAGTGCCCCTGGAGGAGATGGG - Intergenic
998270172 5:140699464-140699486 AAACTACCTCTTGAGGAGACAGG - Intronic
1008982345 6:57499427-57499449 AACCTACCTCAGGAGGAGGTCGG - Intronic
1012889777 6:104885326-104885348 ATGCTACCCCCGGAGGAGTTAGG + Intergenic
1036105187 8:5830485-5830507 AAACCACCCCCAGAGGAGAATGG + Intergenic
1047191316 8:122681481-122681503 AAAATGCAGCCGGAGGAGATGGG - Intergenic
1190993044 X:55572394-55572416 AAACTACCGCAGGAACAGAAAGG + Intergenic
1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG + Exonic