ID: 1200094528

View in Genome Browser
Species Human (GRCh38)
Location X:153650928-153650950
Sequence AAACTACCGCCGGAGGAGAT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 41
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 37}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200094516_1200094528 27 Left 1200094516 X:153650878-153650900 CCCAGATGTCTTGACGGGATCAC 0: 1
1: 0
2: 0
3: 9
4: 46
Right 1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1200094514_1200094528 29 Left 1200094514 X:153650876-153650898 CCCCCAGATGTCTTGACGGGATC 0: 1
1: 0
2: 0
3: 2
4: 38
Right 1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1200094515_1200094528 28 Left 1200094515 X:153650877-153650899 CCCCAGATGTCTTGACGGGATCA 0: 1
1: 0
2: 1
3: 6
4: 58
Right 1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 37
1200094517_1200094528 26 Left 1200094517 X:153650879-153650901 CCAGATGTCTTGACGGGATCACT 0: 1
1: 0
2: 0
3: 6
4: 42
Right 1200094528 X:153650928-153650950 AAACTACCGCCGGAGGAGATGGG 0: 1
1: 0
2: 0
3: 3
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200094528 Original CRISPR AAACTACCGCCGGAGGAGAT GGG Exonic