ID: 1200095354

View in Genome Browser
Species Human (GRCh38)
Location X:153656992-153657014
Sequence CCACCAAGCTAGGCAGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200095354_1200095357 -8 Left 1200095354 X:153656992-153657014 CCTGTATCTGCCTAGCTTGGTGG No data
Right 1200095357 X:153657007-153657029 CTTGGTGGTCAGCCAATGACTGG No data
1200095354_1200095359 28 Left 1200095354 X:153656992-153657014 CCTGTATCTGCCTAGCTTGGTGG No data
Right 1200095359 X:153657043-153657065 TCAAACATCTCAAGCCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200095354 Original CRISPR CCACCAAGCTAGGCAGATAC AGG (reversed) Intergenic
No off target data available for this crispr