ID: 1200100691

View in Genome Browser
Species Human (GRCh38)
Location X:153688102-153688124
Sequence TCCGCGGGCCCCGGCCGGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 366
Summary {0: 1, 1: 1, 2: 1, 3: 38, 4: 325}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200100677_1200100691 10 Left 1200100677 X:153688069-153688091 CCGCCACCGGAGTCGCGGGCCAG 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG 0: 1
1: 1
2: 1
3: 38
4: 325
1200100676_1200100691 13 Left 1200100676 X:153688066-153688088 CCACCGCCACCGGAGTCGCGGGC 0: 1
1: 0
2: 2
3: 18
4: 352
Right 1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG 0: 1
1: 1
2: 1
3: 38
4: 325
1200100672_1200100691 19 Left 1200100672 X:153688060-153688082 CCGCCACCACCGCCACCGGAGTC 0: 1
1: 0
2: 14
3: 66
4: 732
Right 1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG 0: 1
1: 1
2: 1
3: 38
4: 325
1200100684_1200100691 -9 Left 1200100684 X:153688088-153688110 CCAGCCGGGCAGCCTCCGCGGGC 0: 1
1: 0
2: 2
3: 27
4: 283
Right 1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG 0: 1
1: 1
2: 1
3: 38
4: 325
1200100668_1200100691 28 Left 1200100668 X:153688051-153688073 CCGCCGCCGCCGCCACCACCGCC 0: 8
1: 139
2: 1492
3: 2631
4: 8506
Right 1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG 0: 1
1: 1
2: 1
3: 38
4: 325
1200100669_1200100691 25 Left 1200100669 X:153688054-153688076 CCGCCGCCGCCACCACCGCCACC 0: 7
1: 56
2: 444
3: 4671
4: 10224
Right 1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG 0: 1
1: 1
2: 1
3: 38
4: 325
1200100681_1200100691 4 Left 1200100681 X:153688075-153688097 CCGGAGTCGCGGGCCAGCCGGGC 0: 1
1: 0
2: 0
3: 7
4: 112
Right 1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG 0: 1
1: 1
2: 1
3: 38
4: 325
1200100671_1200100691 22 Left 1200100671 X:153688057-153688079 CCGCCGCCACCACCGCCACCGGA 0: 2
1: 1
2: 18
3: 216
4: 1596
Right 1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG 0: 1
1: 1
2: 1
3: 38
4: 325
1200100673_1200100691 16 Left 1200100673 X:153688063-153688085 CCACCACCGCCACCGGAGTCGCG 0: 1
1: 0
2: 9
3: 21
4: 176
Right 1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG 0: 1
1: 1
2: 1
3: 38
4: 325
1200100678_1200100691 7 Left 1200100678 X:153688072-153688094 CCACCGGAGTCGCGGGCCAGCCG 0: 1
1: 0
2: 0
3: 6
4: 75
Right 1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG 0: 1
1: 1
2: 1
3: 38
4: 325

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200100691 Original CRISPR TCCGCGGGCCCCGGCCGGGG CGG Exonic
900121660 1:1050902-1050924 TCCGTGAGCGCCGGCAGGGGCGG - Intronic
900143806 1:1149587-1149609 TCCGCGGGCCCGCCCCGTGGTGG + Intergenic
900192133 1:1356211-1356233 CCCGAGGGCCCTGGCAGGGGAGG + Intronic
900226634 1:1536190-1536212 TCCGCGGCCCCGGGGCGGGCGGG - Intronic
900349270 1:2227276-2227298 TCCGCGGCTCCCGGCCGCGCCGG - Intergenic
900518408 1:3094188-3094210 TCCGCGGCTCCAGGCCTGGGCGG - Intronic
900589807 1:3454585-3454607 TCCGAGGGCCCGGGCGGGGAGGG - Exonic
900671257 1:3856635-3856657 ACCGCCTGCCCCGGCCGGGACGG - Intronic
901433861 1:9234668-9234690 TCCGCTGGCGGCCGCCGGGGCGG - Intergenic
902400834 1:16155863-16155885 TGCGCTGGCCGCGGCCGCGGCGG - Exonic
903830133 1:26169726-26169748 CCCGCGGGCCCTCGCTGGGGAGG - Intergenic
905028372 1:34866046-34866068 ACCGCGGGCCCGGGCCGGGCTGG + Exonic
905272872 1:36798208-36798230 TCCCAGGGCCTCGGCAGGGGCGG + Exonic
906168971 1:43707777-43707799 GCCGCGGGTCCCGGGCTGGGCGG + Intronic
906532822 1:46533217-46533239 GCGGCGGGCCCGGGCCAGGGTGG - Intergenic
906678572 1:47709923-47709945 TCAGCGGGGACCGGGCGGGGTGG + Intergenic
908128248 1:61050835-61050857 TCCGCGGCCTCCCGCCCGGGGGG - Intronic
912246331 1:107965109-107965131 TCCGTGCGCCCCGGCCGGCTCGG + Exonic
914490007 1:148146136-148146158 CCCGGGGGCGCGGGCCGGGGTGG + Intronic
914802974 1:150974189-150974211 CCCGCGGGCCGCTGCCAGGGTGG + Intronic
914815491 1:151059422-151059444 TCCGCCTGGCCCGGCCGGCGCGG + Exonic
915916066 1:159941746-159941768 TCCGCCTGCCCAGGCCTGGGAGG - Intronic
918174421 1:182030169-182030191 TCCGCGGATCCCGCCCGGAGTGG - Intergenic
920184590 1:204152082-204152104 CCCGCGGGCCGGGGCGGGGGCGG - Intergenic
920912528 1:210232510-210232532 TCCCCGGGCACCGGGAGGGGAGG + Intergenic
921172100 1:212558982-212559004 TGCGCGCGGCCCGGCGGGGGCGG + Intergenic
921692249 1:218164859-218164881 CCCCCAGGCCCCGGCCGCGGAGG - Intergenic
922696787 1:227734978-227735000 GCCGCAGACCCCGGGCGGGGAGG - Exonic
923631159 1:235650107-235650129 GGCGCGGGCCCGGGCTGGGGCGG - Intronic
923631260 1:235650307-235650329 TCTGCGGGGCGGGGCCGGGGGGG + Intronic
924414915 1:243849636-243849658 GCCGCGCGGCCCGGGCGGGGAGG + Intronic
924561074 1:245156546-245156568 TCCCCGGGCTCCGGCAGCGGCGG + Exonic
924778400 1:247126818-247126840 GCTGCGGGCGCGGGCCGGGGAGG - Intronic
924783258 1:247171602-247171624 GCTGCGGGCGCGGGCCGGGGAGG + Intronic
1063429564 10:5977255-5977277 CGCGCAGGCCCAGGCCGGGGAGG - Intronic
1065204459 10:23344112-23344134 TCCGTGGGCGGGGGCCGGGGAGG + Intronic
1065367864 10:24952702-24952724 CCGGCGGGCCCGGGGCGGGGCGG - Intergenic
1066656216 10:37701595-37701617 TCAGCGGGCTCAGGCCGGGGAGG + Intergenic
1067040713 10:42951850-42951872 TCAGCGGGCTCAGGCTGGGGAGG + Intergenic
1067043475 10:42970771-42970793 TCTGCCGGCCCAGGCCTGGGTGG - Intergenic
1067071922 10:43138607-43138629 CCCGCCGGCTCCGGCCCGGGCGG + Intronic
1070079166 10:73168404-73168426 GCCGCCCGCCCCGGCTGGGGTGG - Intronic
1071857932 10:89644912-89644934 TGCGCGGGCCCCGGCTCAGGCGG + Exonic
1072784007 10:98268273-98268295 CCCGCAGGCCCCGCCCCGGGCGG + Intergenic
1074864568 10:117537319-117537341 TGCGCGGGCCCTGCCTGGGGTGG - Intergenic
1075430396 10:122375118-122375140 TCAGCGGCGCCCGGCGGGGGAGG + Intronic
1076721968 10:132396832-132396854 TCCCGGGGCTCCGGCCGCGGCGG + Intergenic
1076861628 10:133140622-133140644 GCCGCGGGCCCCAGCCTGTGGGG + Intergenic
1076947943 10:133664834-133664856 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076948933 10:133668144-133668166 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
1076949917 10:133671443-133671465 TCCGGGGGCGCGGGCTGGGGAGG - Intronic
1076950901 10:133674742-133674764 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076951891 10:133678052-133678074 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076952880 10:133681362-133681384 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076953864 10:133684661-133684683 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076954848 10:133741013-133741035 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076955837 10:133744323-133744345 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076956827 10:133747633-133747655 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076957814 10:133750942-133750964 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076958799 10:133754241-133754263 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076959788 10:133757551-133757573 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1076960772 10:133760850-133760872 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
1077038003 11:504475-504497 TCCGCCCGCCCCCGCCTGGGCGG - Intronic
1077076909 11:706159-706181 TCGGCGGGGCCGGGCCGGGGCGG - Exonic
1077138786 11:1014444-1014466 TCCGTGTGCCCCAGCTGGGGAGG + Intronic
1077321765 11:1946088-1946110 TCCGAGGGCCTGGGCCGGGTAGG - Intergenic
1080418652 11:32091649-32091671 CCGCCGCGCCCCGGCCGGGGTGG + Intronic
1082828488 11:57598172-57598194 GGGGCGGGCCCCGGGCGGGGTGG + Intronic
1083607320 11:63986686-63986708 GCCGCGACCCCCGGCCGGGAGGG + Intronic
1083660926 11:64251487-64251509 TCGGCGGGGCCCGGGCGGGGCGG - Intergenic
1083883263 11:65558551-65558573 GCCGCGGGTTCCGGCGGGGGCGG - Intronic
1083945164 11:65919365-65919387 TCCGCGGGAAACGGCGGGGGCGG + Exonic
1084129122 11:67119598-67119620 AACGCGGGCCCCGGCCCCGGGGG - Intronic
1085332913 11:75668062-75668084 GCGGCGGGCCCCGGCCGGAGCGG - Exonic
1085396068 11:76207788-76207810 TCCGCGGGCTGCGGGCGGGCGGG - Intronic
1087141283 11:94768309-94768331 TCCCCGCGCGCGGGCCGGGGAGG - Intronic
1089533857 11:119149220-119149242 CCCGGCGGCCCGGGCCGGGGCGG - Exonic
1090003995 11:122984325-122984347 TCCTGGGGCCCCGGCAGAGGCGG - Intergenic
1090636695 11:128694302-128694324 GCGGCGGGGACCGGCCGGGGAGG + Intronic
1202804783 11_KI270721v1_random:1401-1423 TCCGAGGGCCTGGGCCGGGTAGG - Intergenic
1091718329 12:2795303-2795325 GCCGCGGGCTCCGGGCGCGGCGG - Intronic
1092246549 12:6867385-6867407 TCATCGGGCGGCGGCCGGGGCGG + Exonic
1095465417 12:42483703-42483725 TCGGCGGGGACCGGCCGGGGGGG - Intronic
1096116860 12:49060119-49060141 GCCCCGGGCGCCGGCCGGGGCGG - Intergenic
1096154973 12:49336674-49336696 TCTGCGGGCTCCAGCCGCGGCGG + Exonic
1096491414 12:52015017-52015039 TGCGCGGGCCCTGGCGGGGGCGG + Exonic
1099989705 12:89709079-89709101 CCCGCGGGCCCCGCCCCGAGTGG - Intronic
1101640132 12:106581637-106581659 CCGGCGGGCCGCGGCGGGGGCGG - Intronic
1102026015 12:109714647-109714669 CGCGCGGCCCCCGTCCGGGGCGG + Exonic
1102472613 12:113168088-113168110 GCTGCGGGGCCTGGCCGGGGTGG - Intronic
1103091934 12:118103882-118103904 CCCGAGCGCCCTGGCCGGGGAGG + Exonic
1103604871 12:122078993-122079015 CGCGTGGGCCCGGGCCGGGGTGG - Exonic
1104735023 12:131131267-131131289 GCCGCAGGCCTGGGCCGGGGCGG + Intronic
1104931278 12:132340690-132340712 TCCCCGGGCCCCTTCTGGGGTGG + Intergenic
1106226401 13:27790031-27790053 CCGGCGGGCCGCGGCCGGAGAGG - Intergenic
1106517172 13:30465417-30465439 TGCGCGGAGCGCGGCCGGGGCGG - Intronic
1107467642 13:40665137-40665159 TCCGCCGGGCGCGGCGGGGGAGG - Intronic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1112768721 13:102773500-102773522 CCCGCGGGCACCAGCCGGTGGGG - Intronic
1113493617 13:110712395-110712417 GCCGCGGGTCCCCTCCGGGGTGG - Intronic
1113695604 13:112343278-112343300 CCCGCGGGGCCAGGCCGGGGAGG + Intergenic
1113848038 13:113403569-113403591 TCCCCAGGCCCCGGCCCAGGAGG - Intergenic
1113909261 13:113834490-113834512 TCCGGGGGCCCTCGCCGGTGGGG - Intronic
1113962356 13:114132862-114132884 TCAGCGGGCCCGGGCCGCGCCGG - Intergenic
1114265373 14:21070228-21070250 GCCGCGGGGCCCCGCCAGGGAGG - Intronic
1117157021 14:52951237-52951259 GCTGCGGGTCCCGGGCGGGGCGG + Intronic
1117336419 14:54760369-54760391 CCCGCTGGCCCCGGCCGAGGGGG - Exonic
1119777847 14:77259363-77259385 TCTGGGGCCCCCGGTCGGGGGGG + Exonic
1121595277 14:95157429-95157451 TCCGCAGGCGCCGGCGGGAGGGG - Intronic
1122162269 14:99793236-99793258 GCCGCGGGGCCCGGGCCGGGAGG - Intronic
1122270772 14:100567688-100567710 TCCGCCGGCCCGGGCCGCTGCGG - Intronic
1122719868 14:103716022-103716044 CCCGCGGGGCCGGGCCGGGGCGG - Intronic
1122775919 14:104116942-104116964 TCCGCGCGCCCGCGCGGGGGTGG - Intergenic
1122905627 14:104800392-104800414 CGCGCGGGGCCCGGCCGGGTGGG + Intergenic
1123709777 15:22979282-22979304 CCCGCGGGTCCCGGCCTGGCCGG + Intronic
1123710210 15:22980864-22980886 GCCGCAGGGGCCGGCCGGGGGGG - Intronic
1125485607 15:40108817-40108839 GCGGCGGGCACAGGCCGGGGCGG + Exonic
1125535931 15:40441211-40441233 CCCGCAGGCCCCGGCCGGGCTGG - Exonic
1125828612 15:42695502-42695524 TCCCCAGGCCACGGCCTGGGAGG + Intronic
1126134677 15:45378585-45378607 GCCGCGGGGGGCGGCCGGGGCGG - Exonic
1128280152 15:66387450-66387472 ACCTCGGGGCCCGGCTGGGGAGG + Intronic
1128344023 15:66842551-66842573 TCCGCGGCCCTCGGCGGGGCGGG - Intergenic
1128743114 15:70096835-70096857 GCCGAGAGCCCGGGCCGGGGAGG + Exonic
1129102544 15:73279634-73279656 CACGCGGGCCCCGGGCGTGGTGG - Intronic
1129108245 15:73323243-73323265 TCCCCGGGCCCCGGGTGGCGCGG + Exonic
1129162113 15:73752850-73752872 GCCGGGGGCCCCGGCCGGGCTGG + Intergenic
1129288003 15:74541221-74541243 GCCGGGGGCCACAGCCGGGGCGG - Exonic
1129540253 15:76342562-76342584 TCCGCGTGCTGCGGGCGGGGCGG + Intergenic
1131466023 15:92655502-92655524 TTCCCGGGCCCCGGGCCGGGCGG + Exonic
1132638579 16:966342-966364 GCAGCCGGCCCTGGCCGGGGCGG + Intronic
1132828906 16:1918164-1918186 CCGGCGGGCAGCGGCCGGGGAGG + Exonic
1133056027 16:3145840-3145862 AGGGGGGGCCCCGGCCGGGGAGG + Intronic
1133213100 16:4273774-4273796 GCCGGGGGCCCCGGCAGGGAGGG + Intergenic
1136483788 16:30558264-30558286 CCCTTGGGCCCGGGCCGGGGAGG - Exonic
1136517360 16:30775952-30775974 AGCGCGGGCCGCGGCAGGGGAGG + Exonic
1136719783 16:32310659-32310681 TCCGACGGGCCCGGCAGGGGTGG - Intergenic
1136838158 16:33516939-33516961 TCCGACGGGCCCGGCAGGGGTGG - Intergenic
1139513998 16:67442768-67442790 TCCAGGGGCCACGGCCTGGGTGG + Intronic
1140096884 16:71883616-71883638 TCCTCGGGCCCCGGCGGGGACGG - Intronic
1141455286 16:84137249-84137271 TCCATGGGCCCGGGCCAGGGAGG - Intronic
1141709399 16:85689135-85689157 TCCGCGGGCCGGGGCGGGGCCGG - Intronic
1142336142 16:89490510-89490532 ACCGAGGGCCCCAGCCGGGGAGG - Exonic
1203006648 16_KI270728v1_random:207110-207132 TCCGACGGGCCCGGCAGGGGTGG + Intergenic
1203148328 16_KI270728v1_random:1817219-1817241 TCCGACGGGCCCGGCCGGGGTGG - Intergenic
1142671276 17:1488381-1488403 AGCGCGAGCCCCGGGCGGGGAGG + Intronic
1143904718 17:10199010-10199032 CCCGCGGTCCCCGGCGGTGGGGG - Intergenic
1145190613 17:20840787-20840809 CCCGGGGGCGCGGGCCGGGGTGG + Intronic
1145750786 17:27353846-27353868 CCAGCGTGGCCCGGCCGGGGCGG + Intergenic
1146058716 17:29593579-29593601 GCCGCGGCGCCCGGCCGGGGAGG - Exonic
1147123711 17:38351959-38351981 TCCGGGGGCCGCGGCGGGCGGGG + Intergenic
1147683964 17:42276170-42276192 AGCGCGGGCCCCGCCCGGGCTGG + Intronic
1148593156 17:48831414-48831436 CCCGCGGGCCCAGGCTGTGGTGG + Intronic
1148695589 17:49556318-49556340 TCTCAGGGCCCCGGCCGGTGAGG - Intergenic
1149858081 17:60102667-60102689 GCCGCGGGCCGCGGGCGCGGCGG + Intergenic
1150108567 17:62479029-62479051 GACGCGGGCCCGGGCCCGGGCGG - Exonic
1150228732 17:63538366-63538388 CCAGCGGGACGCGGCCGGGGTGG - Intronic
1150239889 17:63622777-63622799 AGCGCGGGCACAGGCCGGGGCGG - Intronic
1150239921 17:63622868-63622890 TCCGCAGCCCCGGGCCGGGCGGG - Intronic
1150676007 17:67245985-67246007 GCTGCGGGCTCCGGGCGGGGCGG + Intronic
1151320322 17:73348863-73348885 TCCAGGGGCCCGGGCCTGGGAGG + Intronic
1151783838 17:76265640-76265662 GCCGCGGGGCCGGGCCGCGGGGG + Intronic
1152242058 17:79165965-79165987 CCCGCGTGCACTGGCCGGGGAGG + Intronic
1152375010 17:79914496-79914518 GCAGCGGGCACTGGCCGGGGAGG - Intergenic
1152392341 17:80010314-80010336 GCCGCGGCCCGAGGCCGGGGAGG - Exonic
1152721915 17:81927540-81927562 CCGGCGGGCCGAGGCCGGGGCGG + Exonic
1152793062 17:82292607-82292629 TCCCCGGGGTCTGGCCGGGGTGG - Intergenic
1152864599 17:82715182-82715204 TCCGCAGGCCCTGGCCCGAGGGG + Intergenic
1153480534 18:5543211-5543233 GCAGCGGCCCCCGGCCGGTGGGG - Intronic
1153596385 18:6729648-6729670 TTCGCGCGCCCGGGGCGGGGCGG + Intergenic
1153900493 18:9614171-9614193 TCCGCGGGGAGCGGCCGGGGAGG - Intronic
1154202504 18:12308818-12308840 CACGCGGGTCCCGGCCGGGCAGG - Intronic
1157753120 18:50195334-50195356 TCCGCGGGGCCCGGTGCGGGTGG - Intergenic
1157794135 18:50559716-50559738 TCCTCGGGCTCCGTCCGGGAGGG - Intergenic
1158236591 18:55322572-55322594 TCCGCGGGCCCCGGCCTCCCCGG + Intronic
1158427627 18:57353420-57353442 TCCGCGGGCCGGGCCCGGGGCGG + Intronic
1158637650 18:59175679-59175701 TACGTGGGCCCAGGCTGGGGTGG - Intergenic
1158931004 18:62325198-62325220 ACCGCCGGGCCCGGCCGGAGGGG + Intergenic
1160157015 18:76441941-76441963 CACGCGCGCCCCGGCCGAGGAGG - Exonic
1160738712 19:676337-676359 CCCGCGGGCCGCGGGCGGGGCGG - Intergenic
1160745441 19:709101-709123 TCCGCGGTGCCGGGCGGGGGCGG - Exonic
1160790467 19:920593-920615 TCCGAGGGTCCGGGCCGGCGGGG - Exonic
1160930458 19:1567625-1567647 TCGGGGGGCGACGGCCGGGGCGG + Exonic
1160996702 19:1885351-1885373 CCCGGGGGCGCGGGCCGGGGTGG - Exonic
1161073444 19:2273706-2273728 TGCGCAGGCCCAGGCTGGGGCGG - Intronic
1161076994 19:2290616-2290638 GCCGCGCACCTCGGCCGGGGTGG + Exonic
1161281713 19:3449146-3449168 GCCACGGGCCCCTGGCGGGGAGG + Intronic
1161400655 19:4065355-4065377 GCCGCGCGCTGCGGCCGGGGCGG - Intronic
1161554503 19:4932998-4933020 TCCGGGGGCCCCGGGAGGGGAGG - Intronic
1161977735 19:7615620-7615642 TCCGGGGGTCCAGGTCGGGGCGG + Exonic
1161979753 19:7624271-7624293 TCTGGGGGCCCCGGCTGGTGGGG - Intronic
1162524142 19:11197642-11197664 CCCGGGCGCCCCGGCCGCGGTGG + Intronic
1162789450 19:13055398-13055420 TCCGGGGGCCCCGCCAGGGAGGG + Intronic
1162909838 19:13842820-13842842 TCGGCCGGCCCGGCCCGGGGCGG - Intergenic
1162959615 19:14118082-14118104 TCTGCGGGCCCGGGCCGGCGGGG + Intronic
1163631436 19:18419749-18419771 TCCGTGGGCTCCGGCGCGGGCGG + Intronic
1166734490 19:45076118-45076140 TCCGCGGGCCGAGGGCGAGGAGG + Exonic
1166751281 19:45165059-45165081 TGGGCAGGCCCCGGGCGGGGAGG - Intronic
1166873453 19:45884145-45884167 GGCGCAGGGCCCGGCCGGGGAGG - Exonic
1166986189 19:46661082-46661104 GCCGCGGGGCCCGGCCGGGCTGG - Exonic
1167258798 19:48446104-48446126 GCGGCGGCCCCCGGCCGGGCAGG - Exonic
924987771 2:287762-287784 GCGGCGGGGCGCGGCCGGGGGGG - Exonic
925040796 2:731881-731903 TCCCTGGGCCCCAGCCTGGGTGG - Intergenic
925609387 2:5691538-5691560 CCCGCGCGCCCCGCCCCGGGCGG - Intergenic
926268258 2:11344933-11344955 TCCGCGGGGTCCGGCGGGAGGGG - Intronic
926718639 2:15942741-15942763 CCCCGGGGCCCCGGCTGGGGCGG - Exonic
927472505 2:23386168-23386190 GCCCAGGGCCCCGGCCGGGCAGG + Intronic
927679771 2:25131916-25131938 GGCGCGGGGCCGGGCCGGGGCGG + Intronic
929218209 2:39437436-39437458 GCCGCCGGCCCCGGCCTGGCAGG - Intergenic
930096588 2:47570715-47570737 GCCGCGGGCTGCGGGCGGGGTGG + Exonic
930156417 2:48111736-48111758 GCCGGGGGCGCCGGCCGGGGAGG - Intergenic
930762361 2:55050233-55050255 AACGCGGGCTGCGGCCGGGGTGG + Exonic
932496569 2:72148581-72148603 CCGGCGGGCCGCGGCCGGGACGG + Intergenic
933666949 2:84971517-84971539 TCCGCCGCGCCCGGCCCGGGCGG - Intronic
934031822 2:88055456-88055478 TCCGGGGGCGGCGGCCGGTGAGG + Intronic
934714747 2:96537008-96537030 TCAGCGCTCCCCGGCCGGCGCGG + Intronic
935196361 2:100819302-100819324 CCCACGTGCCCCTGCCGGGGAGG + Intergenic
935746481 2:106194012-106194034 AGCGCCGGCCCCGCCCGGGGCGG + Intronic
936954767 2:118013417-118013439 TGCGTGGACCCGGGCCGGGGCGG - Intronic
937208625 2:120252995-120253017 CCCGCGGGCCCCGGGCGGGGTGG + Intronic
937261197 2:120587571-120587593 TTCGCGGGCCCCACGCGGGGCGG + Intergenic
938368840 2:130756263-130756285 GCCGCGCGCCGCGGCCGGGAGGG - Intronic
938416141 2:131105258-131105280 GCGGCGGGCCCCGGCCGGTGGGG - Exonic
942890517 2:180981087-180981109 TCCGCGAGCCGCGGCGGGGCCGG + Intronic
944070008 2:195657621-195657643 CTCGCGGGCCGCGCCCGGGGTGG + Intronic
946366996 2:219254410-219254432 TTCCTGGTCCCCGGCCGGGGCGG + Intronic
946622125 2:221572367-221572389 GCCGCGGGCCCCGGACTGGCGGG - Intronic
948991739 2:241559090-241559112 TGGGCGGCCCCGGGCCGGGGCGG + Intronic
949032420 2:241803293-241803315 ACCGCGGGCCCAGGCCAGGGTGG - Intronic
1168753122 20:297747-297769 TCCGCGAGCCGCGGCCGCCGCGG + Exonic
1168795979 20:610364-610386 CCCTCCGCCCCCGGCCGGGGCGG - Exonic
1169327545 20:4687249-4687271 GCCTCGGGCCTCGGCGGGGGCGG + Intronic
1172474444 20:35226638-35226660 TCCGCGCGCCCCGCCCCGGTGGG - Exonic
1172587087 20:36092595-36092617 TCCGGGGGAGCCGGCCGGGGCGG + Intronic
1172618699 20:36306387-36306409 CCCGCGGGCCGGAGCCGGGGCGG + Exonic
1173322386 20:41999410-41999432 TGCGCGGGGCCGGGCCGGGACGG + Intergenic
1174467981 20:50731854-50731876 TGCGCGGGGCCCGGGCTGGGCGG + Intronic
1175215807 20:57391305-57391327 CCCGCGCGCCCGGGGCGGGGCGG + Intergenic
1175439547 20:58981197-58981219 GCCGCGCGCCTCGGCCCGGGCGG - Exonic
1176242064 20:64079811-64079833 TCCCCGGGCCCGGGCCGGGAGGG + Intronic
1180109726 21:45642445-45642467 CCCGCGGGTCCTCGCCGGGGTGG - Intergenic
1180960580 22:19760680-19760702 TGGGGGGGCCCCGGGCGGGGCGG + Intronic
1181026779 22:20131614-20131636 GCCGCGGGCGCCCGCCGGGCTGG + Intronic
1181042808 22:20200577-20200599 TCCGTGGTGCCCGGCCGGAGGGG + Intergenic
1181082536 22:20424643-20424665 TCCTGGGGCACCGGCCGAGGGGG + Exonic
1181121670 22:20671203-20671225 CCCGGGGGCGCGGGCCGGGGTGG - Intergenic
1181532148 22:23522807-23522829 GCCGCGGGGCCCGGCCGGGCTGG - Intergenic
1182211386 22:28679969-28679991 TCCGACGGGCCCGGCGGGGGTGG - Intergenic
1182447312 22:30397303-30397325 TCCGCGGGCGCGGGCCAGGCTGG - Intronic
1182711370 22:32325346-32325368 TCTTGGGGCCCTGGCCGGGGTGG + Intergenic
1183553451 22:38506819-38506841 TCAGCGGGCCCAGGGCGGTGGGG - Intronic
1183744848 22:39686294-39686316 GCAGCGGTGCCCGGCCGGGGGGG - Exonic
1184101461 22:42343642-42343664 CCCGCGCGCCCCGGCCGGCCCGG + Intergenic
1184330103 22:43821804-43821826 TCTGAGGGCCCTGGCTGGGGTGG + Intergenic
1184523088 22:45007400-45007422 TCCGGCGGCCCGGGCTGGGGTGG + Intronic
1184922913 22:47618348-47618370 TCCACGGGCACCGGCCCAGGTGG - Intergenic
1185330758 22:50251152-50251174 GCGGCGGGCACCGGCCTGGGCGG + Exonic
950197166 3:11017331-11017353 TCCACGTGTCCCGGTCGGGGAGG - Exonic
950632637 3:14293318-14293340 CCCGCGGGCCCCGGGCAGTGAGG + Intergenic
952451791 3:33440156-33440178 CCGGGGGGCCCCGGGCGGGGCGG - Exonic
955770104 3:62377351-62377373 TCTGCGGGGCCTGACCGGGGCGG + Intergenic
960948549 3:122983442-122983464 TCCGCGGGGCGGGGACGGGGCGG + Intronic
963061766 3:141231920-141231942 GGCGCGGGCCTGGGCCGGGGCGG + Intronic
964118818 3:153162098-153162120 TCCGCGGGGCCGGGAGGGGGCGG - Intergenic
968225244 3:196968914-196968936 ACCGCGGGGCCAGGCCGGGCGGG - Intronic
968258151 3:197297891-197297913 TCCGCGGGCCCCGGGCGGGGCGG - Intronic
968323465 3:197791591-197791613 TCCGCCTCCCCCGGCCGGGGCGG - Intronic
968506622 4:973917-973939 TCCGAGGCCCCCGGCCGCGCAGG + Intronic
968512278 4:1001005-1001027 CCCTGGGGCCCTGGCCGGGGCGG + Intronic
969032591 4:4226722-4226744 TCCCCGGCCCCCCGGCGGGGCGG - Exonic
969691580 4:8706909-8706931 CCCCCGGGCCCCGGCGGGGCTGG - Intergenic
972765768 4:42151606-42151628 CCCGCTGCCCCCGGCCGTGGCGG + Intronic
975778775 4:77818940-77818962 TCCTAGGGGGCCGGCCGGGGAGG - Intronic
976092464 4:81472099-81472121 TCCGCGGGCCTCTGCCGCGTGGG - Intronic
979455477 4:120922343-120922365 ACCGCGGGGCACGGCGGGGGTGG - Intronic
980075217 4:128287532-128287554 TCTGGGGGCCGGGGCCGGGGCGG - Exonic
980941650 4:139280283-139280305 TCCGCGGCCCCCGGGAGGTGGGG + Exonic
981708318 4:147684152-147684174 CCCGCGGGGCCAGGACGGGGCGG - Exonic
983938233 4:173517841-173517863 TCCGAGGGCCGGGGCCGGCGAGG - Intergenic
984709445 4:182872998-182873020 ACCGAGGGCCCAGGCTGGGGAGG - Intergenic
985445987 4:190021650-190021672 TCCGGGGGCGCGGGCTGGGGAGG + Intergenic
985452387 4:190068928-190068950 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
985453372 4:190072225-190072247 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985454362 4:190075518-190075540 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985455350 4:190078811-190078833 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985456337 4:190082111-190082133 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985457322 4:190085405-190085427 TCCGGGGGCGCGGGCTGGGGAGG - Intergenic
985458309 4:190088698-190088720 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985459298 4:190091998-190092020 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985463550 4:190174767-190174789 TCCGGGGGCGCGGGCTGGGGAGG - Exonic
985593590 5:777848-777870 TCCATGGGACCCGGCGGGGGCGG + Intergenic
985794552 5:1952516-1952538 TCCGCGGACCCCGGCCTGCCAGG - Intergenic
985895733 5:2749198-2749220 TCCTCGGGCCCTTCCCGGGGAGG - Intronic
986184507 5:5423010-5423032 TCCCGGGGCCCCGGGCGCGGGGG + Intronic
995224988 5:109690883-109690905 TACGCGGGCCCCGGGCTGGCGGG - Intronic
996815569 5:127569563-127569585 CCCGCCGGCCCCGGGCGGTGAGG + Intergenic
998583756 5:143404798-143404820 GACGCGGGCCCTGGCCGGGGTGG - Intronic
1001382264 5:171312400-171312422 GCCGCGGGCCAGCGCCGGGGCGG + Intergenic
1002024585 5:176388386-176388408 GCCGTGGGCCTCGGCCGGGACGG - Intronic
1002061935 5:176630339-176630361 TCCGCTAGGCCAGGCCGGGGTGG + Exonic
1002139864 5:177132396-177132418 GCAGCGGGCGCCGGCCGGCGTGG - Intergenic
1002163699 5:177332194-177332216 GCAGCGGGCCCCTGACGGGGTGG - Exonic
1002539150 5:179894441-179894463 GCCGCGTGCCCCGGCAGGGCTGG - Exonic
1002691635 5:181054089-181054111 TCTGCGGGCCCAGGCTGGGCTGG - Intronic
1003425753 6:5997234-5997256 TGCGGGGGCCCCGGGGGGGGGGG - Intergenic
1004216737 6:13711159-13711181 GCAGCGGGCCCCGGCCCGGCTGG - Exonic
1006152544 6:31997072-31997094 TCCCCGGGCTCTGGCGGGGGTGG + Intronic
1006158850 6:32029809-32029831 TCCCCGGGCTCTGGCGGGGGTGG + Intronic
1013372461 6:109482983-109483005 CCCGCGGGGCCTGGGCGGGGAGG - Intronic
1013538838 6:111087840-111087862 TCCGAGGGTCCCGGGCCGGGCGG - Exonic
1014130811 6:117829954-117829976 TCGGCGGGTCGCGGCCAGGGGGG + Intergenic
1017672246 6:156778741-156778763 GCCGGGGGCCCCGGCGGCGGCGG - Exonic
1019354831 7:573017-573039 GCGGCGGGGCCCGGCCGGTGGGG - Intronic
1019473391 7:1232955-1232977 GGCGCGGGCCGGGGCCGGGGCGG - Exonic
1020091497 7:5344706-5344728 TCCCCTGGCCCCAGCAGGGGAGG - Intronic
1023955624 7:44884855-44884877 GGCGCGGGCCCCGGGCCGGGCGG - Exonic
1024521126 7:50304731-50304753 TGCGCGGCCCGCGCCCGGGGCGG + Intronic
1026458885 7:70596162-70596184 TCCGCGGGCCGGGGCGGGGCTGG + Intronic
1026850379 7:73719753-73719775 TGGGCGGGGCCCGGGCGGGGTGG - Intergenic
1028622209 7:92836705-92836727 GCTGGGGGCCCCAGCCGGGGAGG + Intergenic
1028762445 7:94510317-94510339 TCCGCCGGCCCGGCCCGCGGGGG + Intronic
1029139743 7:98401193-98401215 TGAGCGGGGCCCGGCCGGGGTGG + Intergenic
1029206011 7:98869783-98869805 GCCCTGGGCCCCGGCAGGGGTGG - Exonic
1029438244 7:100574206-100574228 TCCCGGGGTCCCGGGCGGGGTGG + Intronic
1029505811 7:100963569-100963591 GCCACGGCACCCGGCCGGGGAGG + Intronic
1031008377 7:116499547-116499569 TCCCTGCGCCCCGGCGGGGGAGG + Exonic
1031043577 7:116862991-116863013 TCCCCGGTCCCCGGCCCCGGCGG - Intronic
1033654370 7:143362815-143362837 TCGGCTCGCCGCGGCCGGGGAGG + Intergenic
1034147060 7:148883588-148883610 GGCGCGGGCCGCTGCCGGGGTGG - Intronic
1034522682 7:151632480-151632502 GACGCGGGCCACGGCCGGAGGGG - Intronic
1034618150 7:152436202-152436224 GCCGCGGGGCCCGGCGGGGGCGG + Intergenic
1035022040 7:155805821-155805843 TCCACGGGCGCCCGGCGGGGAGG + Intronic
1037807532 8:22066904-22066926 TCGGCGGCCCCGGCCCGGGGCGG - Intronic
1037826837 8:22164960-22164982 CCCGCGGCCCGCGGCCCGGGCGG + Exonic
1038147681 8:24913645-24913667 ACTGCGGGCACCGGTCGGGGAGG - Exonic
1039542943 8:38386547-38386569 TCCGCGGAGCCCGGCCGAGGAGG + Exonic
1039884314 8:41646607-41646629 GCCCCGGGCCCCGGGCGGCGCGG - Exonic
1039907544 8:41797787-41797809 TCCCCAGGCCTCGGCCGGCGCGG + Intronic
1040038758 8:42896436-42896458 TCCGCGGGCCCCGATAGGGTGGG + Exonic
1047542551 8:125784714-125784736 TCCATGGGCACAGGCCGGGGAGG - Intergenic
1049472860 8:142784026-142784048 TCTGCTGGCCGCGGCCGGAGGGG + Intergenic
1049828515 8:144685472-144685494 TGTGCGGGGCCCGGCCGGGCGGG - Intergenic
1050472543 9:6008037-6008059 TGCGCGCGCCGCCGCCGGGGGGG - Intergenic
1051334287 9:16052642-16052664 GCCCCGGGCCCTGGCTGGGGAGG - Intronic
1053239936 9:36487394-36487416 GCGGCGGGCTCCGGCCGGGGCGG + Intronic
1053600503 9:39604222-39604244 GCGGCGGGCCGCAGCCGGGGTGG - Intergenic
1053858151 9:42358078-42358100 GCGGCGGGCCGCAGCCGGGGTGG - Intergenic
1054253026 9:62738162-62738184 GCGGCGGGCCGCAGCCGGGGTGG + Intergenic
1054567142 9:66772661-66772683 GCGGCGGGCCGCAGCCGGGGTGG + Intergenic
1057773025 9:97984038-97984060 TCCGCGCGCCCCGGGCCGGCCGG + Intronic
1060296511 9:122347085-122347107 TTCGCGGGCCGCGGCCCGGCAGG + Intergenic
1060661740 9:125408631-125408653 TCTGCGGGCCCTGGTCAGGGAGG + Intergenic
1061060945 9:128250387-128250409 CCCGCGGGCCCCGGGCTGGGGGG - Intronic
1061248387 9:129413290-129413312 GCCGCGGGGCCCGGACGGGGTGG + Intergenic
1061450252 9:130663775-130663797 GACGCGGGCTCTGGCCGGGGAGG + Intergenic
1061489713 9:130938397-130938419 TCCGGAGGCCCGGGCCGGGATGG - Intronic
1061680613 9:132241060-132241082 TCCGCAGGCCCCGCCCACGGGGG - Intronic
1061808488 9:133149229-133149251 TCCCCGGGCTCGGGCCCGGGTGG + Intronic
1061975713 9:134067356-134067378 GCCGCGCGCCGCGGCCGGGGCGG - Intronic
1062209480 9:135356013-135356035 GCCGGGGGCTCCGGCTGGGGAGG - Intergenic
1062534368 9:137015056-137015078 TCAGCGGGGCCCGACCTGGGGGG + Exonic
1062574533 9:137200160-137200182 ACCGCGGGGCCCGGGCGCGGCGG + Exonic
1062574553 9:137200194-137200216 GCCGCGGGCGGGGGCCGGGGCGG + Exonic
1062653426 9:137590120-137590142 TGTGCGGGCGGCGGCCGGGGCGG - Intronic
1187067452 X:15854692-15854714 GCCGCGGGCCGCGGGCGCGGCGG + Exonic
1200086891 X:153611425-153611447 TCTGCCTGCCCCGGCCCGGGGGG - Intergenic
1200100691 X:153688102-153688124 TCCGCGGGCCCCGGCCGGGGCGG + Exonic