ID: 1200100712

View in Genome Browser
Species Human (GRCh38)
Location X:153688154-153688176
Sequence CGCCCGCGGTCTGCAAGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 1, 2: 2, 3: 2, 4: 54}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200100712_1200100725 19 Left 1200100712 X:153688154-153688176 CCGCCGCTTGCAGACCGCGGGCG 0: 1
1: 1
2: 2
3: 2
4: 54
Right 1200100725 X:153688196-153688218 GCTAGGCTGAGCCTCGGGTCGGG 0: 1
1: 0
2: 0
3: 10
4: 149
1200100712_1200100724 18 Left 1200100712 X:153688154-153688176 CCGCCGCTTGCAGACCGCGGGCG 0: 1
1: 1
2: 2
3: 2
4: 54
Right 1200100724 X:153688195-153688217 CGCTAGGCTGAGCCTCGGGTCGG 0: 4
1: 0
2: 0
3: 9
4: 78
1200100712_1200100716 2 Left 1200100712 X:153688154-153688176 CCGCCGCTTGCAGACCGCGGGCG 0: 1
1: 1
2: 2
3: 2
4: 54
Right 1200100716 X:153688179-153688201 GATGTCGCCCGCGCCCCGCTAGG 0: 1
1: 2
2: 1
3: 2
4: 144
1200100712_1200100720 14 Left 1200100712 X:153688154-153688176 CCGCCGCTTGCAGACCGCGGGCG 0: 1
1: 1
2: 2
3: 2
4: 54
Right 1200100720 X:153688191-153688213 GCCCCGCTAGGCTGAGCCTCGGG 0: 4
1: 0
2: 2
3: 15
4: 162
1200100712_1200100719 13 Left 1200100712 X:153688154-153688176 CCGCCGCTTGCAGACCGCGGGCG 0: 1
1: 1
2: 2
3: 2
4: 54
Right 1200100719 X:153688190-153688212 CGCCCCGCTAGGCTGAGCCTCGG 0: 3
1: 1
2: 1
3: 9
4: 107
1200100712_1200100726 24 Left 1200100712 X:153688154-153688176 CCGCCGCTTGCAGACCGCGGGCG 0: 1
1: 1
2: 2
3: 2
4: 54
Right 1200100726 X:153688201-153688223 GCTGAGCCTCGGGTCGGGCGAGG 0: 1
1: 3
2: 1
3: 33
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200100712 Original CRISPR CGCCCGCGGTCTGCAAGCGG CGG (reversed) Exonic
902116877 1:14128491-14128513 AGGCCGCTGTCTGCAAGCCGAGG - Intergenic
903652992 1:24932420-24932442 CGCCCGCGCCCTGCCAGCCGCGG + Intronic
905449124 1:38046065-38046087 CGCGGGCGGCCTGCACGCGGCGG - Exonic
908523435 1:64966276-64966298 CGGCCGCGGTCGGCAGGCGAGGG - Intronic
916656834 1:166884241-166884263 CACCCGCTTTCTGCAGGCGGCGG - Intergenic
1064231059 10:13529252-13529274 CGAGCGGGGTCTGCGAGCGGAGG - Intergenic
1066180571 10:32957897-32957919 CGCCCGGGGGCTGCCAGCGCCGG + Intronic
1066211610 10:33245230-33245252 CGCCAGCGGTTTTCAAGTGGGGG + Intronic
1072491265 10:95907922-95907944 CGCCCGCGGGCTGCAAGTAGCGG - Intronic
1076710588 10:132331814-132331836 CGCCCGCGGCCTTGAAGGGGTGG - Intronic
1076874599 10:133209860-133209882 CGGCCACGGTCAGGAAGCGGAGG - Intronic
1083780976 11:64917161-64917183 CGCCGGCGGGCGGCAAGCGGAGG - Exonic
1086887830 11:92224963-92224985 CGCCGGGGGTTCGCAAGCGGAGG - Intergenic
1090210998 11:124921091-124921113 CGCCCGCGGTCTGCGGCCAGTGG - Exonic
1096251028 12:50032838-50032860 CGCGCGGGGGCGGCAAGCGGGGG + Intronic
1102116005 12:110403464-110403486 CGGCGGCGGTCTGGGAGCGGGGG - Intronic
1103749788 12:123150879-123150901 CGCCCGGGGCCAGCAGGCGGCGG - Intergenic
1103828847 12:123762685-123762707 CGCCCGGGGCCTGCACGTGGCGG - Intronic
1107467570 13:40664893-40664915 CGCCGGCGCTCCGCAGGCGGTGG + Intronic
1119325963 14:73759718-73759740 CGGCCGAGGCCTGCACGCGGCGG - Intronic
1119437992 14:74610688-74610710 CGCCCGCGGTGGGCAGGGGGTGG + Intronic
1121051436 14:90821219-90821241 CGCCCCGGGCCTGCAAGCTGTGG - Intergenic
1127415142 15:58749972-58749994 CGCCGGCGGACAGGAAGCGGCGG - Exonic
1132602490 16:779928-779950 CGCCAGCAGTCTGCACGCTGAGG - Intronic
1136779081 16:32885894-32885916 CGCTCGCAGTCTGCAAGCGGCGG + Intergenic
1136891537 16:33975624-33975646 CGCTCGCAGTCTGCAAGCGGCGG - Intergenic
1139448760 16:67014362-67014384 CGCCAGCAGTCTCCAGGCGGGGG + Intergenic
1203081493 16_KI270728v1_random:1147982-1148004 CGCCCGCAGTCTGCAAGCGGCGG + Intergenic
1165300326 19:34964258-34964280 GGCCCGAGGGCTGCAGGCGGCGG - Intergenic
1167578336 19:50328329-50328351 CGCCCGCGTCCTGGAAGCAGAGG + Exonic
926422904 2:12716774-12716796 CGCCCGAGGACTGGCAGCGGCGG + Intergenic
927181029 2:20446936-20446958 CGCCCTCGGGCTGCAGGGGGCGG + Intergenic
941384940 2:164841387-164841409 CGCCCGCGGGCTGGGAGCCGGGG - Exonic
946361892 2:219223898-219223920 CGTCCCGGGTCTGCGAGCGGTGG + Exonic
1169208185 20:3751617-3751639 CGCCCGCGGTCTGCGTGTCGTGG + Exonic
1171977385 20:31604240-31604262 CGCCCGGGGTCTGCAGGTGACGG + Intergenic
1174404542 20:50294853-50294875 AGCCTGGGGTCTGCACGCGGTGG - Intergenic
1176122542 20:63460578-63460600 CGCCGGAGGTGTGCAAGTGGAGG - Intronic
1176207117 20:63895212-63895234 CGCCCGGGGTCTCCAGGCTGAGG + Exonic
1178726099 21:35052979-35053001 CACCTGCAGTCTGCAAGCAGAGG - Intronic
1182561096 22:31160079-31160101 CGCCTGCGGGCAGGAAGCGGAGG - Intergenic
953099483 3:39810436-39810458 CGCCCGCGGGCTGCCTGGGGAGG + Intronic
954404967 3:50340631-50340653 GCCCCGCGGGCTGGAAGCGGTGG + Exonic
962322999 3:134406822-134406844 AGCCCGCCGGCTGCAGGCGGCGG + Intergenic
968963676 4:3758568-3758590 CGCCTGGGGTGTGCAAGCAGAGG + Intergenic
969912257 4:10457365-10457387 CGCCGGCGGTCTGCGGCCGGCGG - Intronic
974716017 4:65669690-65669712 CGCCGGCGGCCCCCAAGCGGCGG - Exonic
976608681 4:87007049-87007071 CGCCGGCGGTCTTCGAGCGTGGG + Intronic
1004131799 6:12927932-12927954 CACCCACGGTCAGCAATCGGAGG - Intronic
1012916707 6:105179322-105179344 CGCCCCCGGTCTGTAAGCAAAGG - Intronic
1022795260 7:33726979-33727001 CCCCCGCGGTGGGCAAGCTGGGG + Intronic
1032151688 7:129434639-129434661 CGCCCGCCGGCGGGAAGCGGCGG + Intronic
1035171594 7:157020373-157020395 CCCCCGCGGTCTGCGTGGGGAGG - Intergenic
1035265616 7:157689066-157689088 CGCCCGGGGGCTGCGAGCGCCGG - Intronic
1035431726 7:158828497-158828519 CGCTCGGGGTCTGCAGGCCGGGG + Intronic
1039949130 8:42153732-42153754 CTCCAGCGGTCTGCCCGCGGAGG + Intronic
1057313423 9:93955164-93955186 CGCCCGCGGTTTGGCGGCGGCGG + Exonic
1185623339 X:1466573-1466595 CGCCCGGGCTCTGCAAGGGAAGG + Exonic
1200092910 X:153644202-153644224 CGCGCGAGGCCTGCAGGCGGCGG + Intronic
1200100712 X:153688154-153688176 CGCCCGCGGTCTGCAAGCGGCGG - Exonic