ID: 1200100904

View in Genome Browser
Species Human (GRCh38)
Location X:153688717-153688739
Sequence CCGTGCCGCCGCGCGAGACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 58}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200100895_1200100904 10 Left 1200100895 X:153688684-153688706 CCGTGGGCCTGGGGACACCCGGC 0: 1
1: 3
2: 0
3: 33
4: 289
Right 1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 58
1200100888_1200100904 25 Left 1200100888 X:153688669-153688691 CCAAGGGCGACGGCCCCGTGGGC 0: 1
1: 3
2: 0
3: 4
4: 110
Right 1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 58
1200100897_1200100904 3 Left 1200100897 X:153688691-153688713 CCTGGGGACACCCGGCGGCCGCC 0: 1
1: 2
2: 3
3: 24
4: 172
Right 1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 58
1200100899_1200100904 -7 Left 1200100899 X:153688701-153688723 CCCGGCGGCCGCCTGGCCGTGCC 0: 1
1: 2
2: 3
3: 18
4: 247
Right 1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 58
1200100893_1200100904 11 Left 1200100893 X:153688683-153688705 CCCGTGGGCCTGGGGACACCCGG 0: 1
1: 3
2: 2
3: 20
4: 235
Right 1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 58
1200100884_1200100904 30 Left 1200100884 X:153688664-153688686 CCCGGCCAAGGGCGACGGCCCCG 0: 4
1: 0
2: 1
3: 11
4: 109
Right 1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 58
1200100892_1200100904 12 Left 1200100892 X:153688682-153688704 CCCCGTGGGCCTGGGGACACCCG 0: 1
1: 3
2: 0
3: 16
4: 174
Right 1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 58
1200100900_1200100904 -8 Left 1200100900 X:153688702-153688724 CCGGCGGCCGCCTGGCCGTGCCG 0: 1
1: 2
2: 2
3: 17
4: 194
Right 1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 58
1200100885_1200100904 29 Left 1200100885 X:153688665-153688687 CCGGCCAAGGGCGACGGCCCCGT 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG 0: 1
1: 0
2: 0
3: 9
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200100904 Original CRISPR CCGTGCCGCCGCGCGAGACC TGG Exonic
907501953 1:54887376-54887398 CCCCGCCGCCGCGCGAGGCGGGG + Intergenic
908534854 1:65067501-65067523 GCGTGCGGCCGCGCGAGGCTCGG - Intergenic
915511336 1:156388537-156388559 CCGCGCCGCCCCGCGCGCCCCGG + Intergenic
916483388 1:165235609-165235631 CCGCGCCGCCGCGCGTTCCCAGG - Intronic
922416688 1:225428278-225428300 CCGGGCCGCCCCGCCAGACTCGG - Intronic
1063201105 10:3785727-3785749 CCCTGTCGCCGCGCGAGCCCCGG + Intergenic
1075802605 10:125161845-125161867 CCGGGCCGCCGCGCAAGCCCAGG - Intergenic
1076723216 10:132401745-132401767 CAGTGAGGCCGAGCGAGACCAGG - Intronic
1077065573 11:639662-639684 CCGTGCCGCTGCGCTACAACCGG + Exonic
1077636041 11:3841549-3841571 CCGTGCAGCCCTGCGAGGCCTGG + Intergenic
1080283619 11:30585465-30585487 TCGGGCCGCCGCGGGAGCCCGGG + Intronic
1083428705 11:62602585-62602607 CCTTGCCGCCCAGCGAGACGAGG + Exonic
1083448531 11:62727078-62727100 CCTTGAGGCCGCGCGAGTCCAGG + Exonic
1088401063 11:109422945-109422967 CCGGGCCGCCGCGCGGGCTCCGG - Intronic
1090383723 11:126344504-126344526 CCCTGCAGCGGGGCGAGACCAGG - Intronic
1093662585 12:21774621-21774643 CCATGCTGGCGCGCGGGACCAGG + Exonic
1103309041 12:119989751-119989773 GCGTGCCGCGGCGCGAGGCGAGG + Intergenic
1117478301 14:56118753-56118775 CCGCGCCGCTGCCCGGGACCAGG - Intronic
1122137859 14:99645134-99645156 CCCTGCCGCCGCGAGCGCCCCGG + Exonic
1122873711 14:104653274-104653296 CCCAGCCGCCGCGCCAGGCCTGG - Intergenic
1122873721 14:104653311-104653333 CCCAGCCGCCGCGCCAGGCCTGG - Intergenic
1122904359 14:104795207-104795229 CCGCTCCGCCGGGCGAGGCCGGG - Intronic
1124211785 15:27770264-27770286 CCGTGGCCCCGCGCGCGACCAGG - Intronic
1127789886 15:62390435-62390457 CCGCGGCGCCGCGCGGCACCGGG - Intergenic
1132146937 15:99434804-99434826 CCGAGCTGCCCAGCGAGACCTGG + Intergenic
1136390647 16:29962151-29962173 CGGATCCGACGCGCGAGACCGGG + Intronic
1141629048 16:85276950-85276972 CCGTGCAGCCGGGCCAGGCCTGG + Intergenic
1143719401 17:8799244-8799266 CCGCGGCGCCGCCCCAGACCGGG - Exonic
1144953154 17:19004655-19004677 CGGCGACGCCCCGCGAGACCCGG + Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1150239939 17:63622914-63622936 CCGGGCCGCGGCGCGCGAGCGGG - Intronic
1157610102 18:48950613-48950635 CCGGGCCCCCGCGCGCGCCCCGG - Exonic
1159040540 18:63319919-63319941 CAGCGCCGCCGCGCAGGACCAGG - Exonic
1163334335 19:16661146-16661168 CCGTCCCGCCGCCCGCGGCCCGG - Exonic
1163681191 19:18683619-18683641 CCGTGCCACCGCGCAAGCGCCGG - Intergenic
1165419983 19:35717882-35717904 CAGCGCCGCCGCGGGAGACCGGG - Intergenic
926122901 2:10254490-10254512 CCGAACCGCCGCGCCAGGCCCGG - Intergenic
927973910 2:27323316-27323338 CCTTCTCTCCGCGCGAGACCCGG + Intronic
1173690855 20:44960124-44960146 GCTGGCCGCCGCGCGAGGCCCGG + Intronic
1176068978 20:63216271-63216293 CCGCCCCGCCGCACGAGACTGGG - Intergenic
1184620415 22:45672224-45672246 CGGGGCCGCCGCGGGAGTCCCGG - Intronic
1185296781 22:50058520-50058542 CGGGGCCGCAGCGCGTGACCCGG - Intergenic
950627523 3:14259110-14259132 CCCTGCCCCCGCCAGAGACCAGG + Intergenic
961081521 3:124032922-124032944 CGGGGCCGCCGGGCGAGCCCGGG - Intergenic
961144770 3:124584723-124584745 CAGCGCCGCCGCCCGAGAGCCGG - Intronic
961402070 3:126654708-126654730 CGGTTCCACCGCGCGCGACCGGG - Intronic
968514244 4:1009753-1009775 GCGTGCCGGCGCGGGAGGCCCGG + Intergenic
968907981 4:3463339-3463361 CCGCGCCGCCGCGCTCGCCCCGG - Exonic
969416977 4:7067475-7067497 CCGTGCCGCAGCTCGAGGCCGGG - Intronic
972396521 4:38663733-38663755 CCGCGCCGCCGCCCGAGCCCGGG - Intergenic
986315325 5:6583118-6583140 CCGCGGCGCCGCGCAGGACCCGG + Intergenic
990308799 5:54518558-54518580 CCGAGCCGCCGCGGGAACCCAGG - Exonic
1002090722 5:176804157-176804179 CCGTGCCTCGGCGCAAGAACTGG - Intergenic
1002895583 6:1378382-1378404 CTGTGCCGCCTCGCGAGTCCTGG + Intergenic
1013099167 6:106973712-106973734 CCGCGCCGGCGAGAGAGACCGGG - Exonic
1017311559 6:152982713-152982735 CGCTGCCGCCGCCCGAGGCCGGG + Intronic
1020118761 7:5491349-5491371 GGGTGCCGCTGCGAGAGACCAGG + Exonic
1022989629 7:35694934-35694956 CCGCGCCTCCTCGCGAGACCCGG - Exonic
1025017227 7:55449329-55449351 CAGTGGCGCCGCGGGAGACTGGG - Intronic
1032693859 7:134316629-134316651 CCGCCCCGCCCCGGGAGACCGGG + Intronic
1034433245 7:151051263-151051285 CCGCGCCGCCGCGCGCTTCCTGG + Exonic
1036195271 8:6708499-6708521 CCGCGCCGCCGCCCGGGGCCGGG - Exonic
1049531970 8:143159516-143159538 CCGAGGCGCCGCGGGAGAGCCGG - Intronic
1049585038 8:143429150-143429172 CCGGGCCGACGCGCGCGAACGGG + Exonic
1049616596 8:143578277-143578299 CCGCGCCGCCGCGCGCGCCTCGG + Exonic
1057314688 9:93960719-93960741 CCAGGCCGCAGCTCGAGACCTGG + Intergenic
1057489102 9:95508220-95508242 CCGTGCTGCCGCGCCGGACCGGG - Exonic
1200100904 X:153688717-153688739 CCGTGCCGCCGCGCGAGACCTGG + Exonic