ID: 1200101020

View in Genome Browser
Species Human (GRCh38)
Location X:153689073-153689095
Sequence TGCCCCCCAGACTCCCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 3, 2: 4, 3: 25, 4: 261}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200101011_1200101020 19 Left 1200101011 X:153689031-153689053 CCTGGCATGGTGGGGGGAGGGGG 0: 1
1: 2
2: 26
3: 198
4: 1784
Right 1200101020 X:153689073-153689095 TGCCCCCCAGACTCCCGGGCTGG 0: 1
1: 3
2: 4
3: 25
4: 261
1200101015_1200101020 -4 Left 1200101015 X:153689054-153689076 CCGGCGATGCCCGCGAGGCTGCC 0: 4
1: 0
2: 1
3: 7
4: 87
Right 1200101020 X:153689073-153689095 TGCCCCCCAGACTCCCGGGCTGG 0: 1
1: 3
2: 4
3: 25
4: 261

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200101020 Original CRISPR TGCCCCCCAGACTCCCGGGC TGG Intronic
900010436 1:102381-102403 TGCCCCTCAGACTTCCAGGGAGG - Intergenic
900026541 1:278946-278968 TGCCCCTCAGACTTCCAGGGAGG - Intergenic
900036327 1:412789-412811 TGCCCCTCAGACTTCCAGGGAGG - Intergenic
900057955 1:648544-648566 TGCCCCTCAGACTTCCAGGGAGG - Intergenic
900116991 1:1033181-1033203 GGCGCCCCCGACTCCCGCGCGGG - Intronic
900151488 1:1180982-1181004 GGCCACCCAGGCTCCCAGGCTGG + Intronic
900556683 1:3284126-3284148 TCCACCCCAGCTTCCCGGGCGGG - Intronic
900793124 1:4692366-4692388 TGCCCCCCAGCCTCTCCTGCAGG - Intronic
900806821 1:4772965-4772987 TACCCACCAGACTCCCAGACCGG + Intronic
901086049 1:6613264-6613286 TGCCGCCCCTACTCCCGGCCAGG + Intronic
901137925 1:7009671-7009693 TGTCCCCCAGAGCCCCGGTCCGG + Intronic
901493016 1:9606192-9606214 TGCCCCCAAGACTCCAGGGAAGG - Intronic
901534104 1:9871548-9871570 CGCCCCTCAGCCTTCCGGGCAGG - Intronic
903265789 1:22157142-22157164 AGCCCCCCAGACACCCTGGCTGG - Intergenic
903540733 1:24094813-24094835 TGGCCCCCAGCCTCCAGAGCTGG - Intronic
903787834 1:25873250-25873272 TGCCCTCCCGCCTCCAGGGCTGG - Intergenic
904915892 1:33970542-33970564 TGCCCCCCACCCTTCCTGGCAGG + Intronic
905041451 1:34963033-34963055 TCCCACCCAAACTCCTGGGCAGG - Intergenic
911178807 1:94843195-94843217 TGCCACCCAGATTTCAGGGCCGG + Intronic
912542168 1:110425335-110425357 TGCAGCCCTGACTCCTGGGCTGG + Intergenic
913122781 1:115756915-115756937 TGTCACCCAGGCTCCCCGGCTGG - Intronic
915895488 1:159808453-159808475 TGCCCCACAAACTCCCAAGCTGG - Intronic
915920791 1:159973767-159973789 TGCCCCACAAACTCCCAAGCTGG + Intergenic
917304749 1:173613676-173613698 CGCCCCCCAACCTCCCGGACGGG - Intronic
917345243 1:174022388-174022410 TCCGCCCCAGTCTCCGGGGCGGG - Intergenic
918480725 1:184974270-184974292 TGCTCCCCAGGCCCCCGGGCGGG + Intronic
922258875 1:223918387-223918409 TGCCCCTCAGACTTCCAGGGAGG - Intergenic
922525505 1:226299966-226299988 TGTCACCCAGACTCCCAGACTGG + Intronic
922721835 1:227903556-227903578 TGTCCCCCAGACCCCAGGGTAGG - Intergenic
922721920 1:227903784-227903806 CGTCCCCCAGACCCCAGGGCGGG - Intergenic
922750070 1:228066118-228066140 TGTCTCCCAGACCCCAGGGCAGG - Intergenic
922789918 1:228305863-228305885 TGTCCCCCAGACTCCAGGGCAGG - Intronic
923505133 1:234599259-234599281 TGCCCCCCCAACTCCAAGGCTGG + Intergenic
924340064 1:243021136-243021158 TGCCCCTCAGACTTCCAGGGAGG - Intergenic
1065322274 10:24520814-24520836 TGCCACCCAGGCTGCCAGGCTGG - Intronic
1067369878 10:45673002-45673024 TGCCCTCCAGACGCCCGCGTGGG - Intergenic
1067391207 10:45865507-45865529 TGCCCCCCCACCTCCCGGACGGG + Intergenic
1067872072 10:49970604-49970626 TGCCCCCCCACCTCCCGGACGGG - Intronic
1068933032 10:62610882-62610904 TGATCCCCAAACCCCCGGGCTGG - Intronic
1069581952 10:69572505-69572527 TACTCCCCAGTCTCCCAGGCTGG - Exonic
1069633722 10:69912995-69913017 TGCCACTCAGACTCCCCAGCTGG - Intronic
1069709380 10:70479034-70479056 TGCCCCCCGGAGCCGCGGGCTGG + Exonic
1070140281 10:73733266-73733288 TGGCGCCCAGACTCCGGGGCCGG - Intergenic
1070491851 10:76984230-76984252 TGTCACCCAGGCTCCCAGGCTGG + Intronic
1070811059 10:79298396-79298418 TTCCCTCCAGCCTCCCAGGCCGG + Exonic
1071311334 10:84347364-84347386 TGCCCCCCCACCTCCCGGACGGG + Intronic
1072788869 10:98303258-98303280 TGTTCCCCAGAGTCCCTGGCTGG - Intergenic
1073044415 10:100628465-100628487 TCCCCCCCACACACCTGGGCAGG + Intergenic
1074861259 10:117512156-117512178 CGCCCCCCACACCCCCCGGCTGG + Intergenic
1075056723 10:119224206-119224228 TGCCCTCCAGATTCCCAGACTGG + Intronic
1075093050 10:119454031-119454053 AGCCTCCCAGGCTCCAGGGCGGG - Intronic
1075651077 10:124128667-124128689 TGCCACCCAGAATGCCAGGCTGG + Intergenic
1075671732 10:124267792-124267814 TGACCCCCACATTCCCTGGCAGG - Intergenic
1076324889 10:129613526-129613548 TACACCCCAGACTCCAGGGAGGG - Intronic
1076554165 10:131311396-131311418 TGCTCCCCGGTCTCCCCGGCTGG - Exonic
1076871426 10:133196840-133196862 TGTCCCCCAGGCTCCCTGGGAGG - Intronic
1077278987 11:1733442-1733464 TGCACCCCAGGCCCACGGGCAGG + Exonic
1080387128 11:31816847-31816869 GCCGCCCCAAACTCCCGGGCGGG + Intronic
1080581058 11:33643993-33644015 TGCCCCCCAAACTCCTGGGCTGG - Intronic
1080638883 11:34147035-34147057 TCTCCCGCAGACTCCTGGGCTGG - Intronic
1081653364 11:44840259-44840281 TGCCTCCCCCACTCCCTGGCTGG - Intronic
1081998019 11:47377252-47377274 TGCCTCCCAGCCTCCTGGGGTGG + Intronic
1082265196 11:50110371-50110393 TGCCACCCAGGCTCCCAGGCTGG - Intergenic
1084045009 11:66563363-66563385 GGCCCCTCAGGCTCCTGGGCAGG + Intergenic
1084099522 11:66936867-66936889 TGTCACCCAGGCTCCCAGGCTGG + Intronic
1084438514 11:69157623-69157645 TGCCCGCCAGACTCCAGCCCGGG - Intergenic
1085886889 11:80532736-80532758 TGCCCACCAGTCTCCTTGGCTGG + Intergenic
1090427694 11:126620375-126620397 AGCCCCTCAGAATCCTGGGCTGG - Intronic
1092241228 12:6837631-6837653 TGCCCCCAAGAGCCCCGGGGTGG + Intronic
1093927484 12:24923442-24923464 TGTCACCCAGGCTCCCAGGCTGG + Intronic
1096125657 12:49117555-49117577 TGTTGCCCAGACTCCCAGGCTGG - Intergenic
1096385992 12:51195889-51195911 TTCCCTCCAGACTGCCAGGCAGG - Intronic
1097228537 12:57495093-57495115 TGCCCCCCCACCTCCCGGGCTGG + Intronic
1100841066 12:98612258-98612280 TGTCTCCCAGTCTCCCAGGCTGG + Intergenic
1103210849 12:119165307-119165329 TGCAGCCCAGACACCTGGGCTGG - Intergenic
1103700547 12:122846826-122846848 GGCCCCCCAGCTTCCCGGGCTGG + Intronic
1103844706 12:123893319-123893341 TGCCACACAGACTCCTTGGCCGG - Exonic
1104441501 12:128797145-128797167 CGCCCCCCAGGCTCACAGGCAGG + Intronic
1104865381 12:131950296-131950318 GGCCCCCCGGGCTCCTGGGCTGG + Intronic
1104945071 12:132412112-132412134 TGGCCCCCAGACTCCCCAGCAGG - Intergenic
1108206409 13:48094826-48094848 TGCACCCGAAACTCCCGAGCTGG + Intronic
1110925763 13:81149537-81149559 TGCCCCCCAGACCCCAGCGCAGG - Intergenic
1112304272 13:98259543-98259565 TGCCCCCCAGGTTTCCTGGCTGG + Intronic
1113812256 13:113149903-113149925 TGACCCGCAGACTCCCTGGGAGG + Intergenic
1113906647 13:113822398-113822420 TCCCCCACAGCCTCCCAGGCTGG - Intronic
1114275325 14:21137995-21138017 TGTCTCCCAGGCTCCCAGGCTGG - Intergenic
1115755139 14:36521353-36521375 TGCCTCCAAGACACCCGCGCTGG + Intergenic
1119431027 14:74568020-74568042 TGCCACCCAGACTGGGGGGCAGG + Intronic
1121020677 14:90578392-90578414 GCCCCGCCAGACTCCCGTGCAGG - Intronic
1121631162 14:95422847-95422869 TGTCCCCAAGACTCCCAGGAAGG + Intronic
1122209571 14:100165995-100166017 CTCCCCCCACTCTCCCGGGCAGG - Intergenic
1122209591 14:100166041-100166063 CTCCCCCCACTCTCCCGGGCAGG - Intergenic
1122982303 14:105197193-105197215 GGACCCCCAGACCCCAGGGCGGG - Intergenic
1124093701 15:26629316-26629338 TGCCCGCCAGGCTCCTGAGCTGG - Intronic
1124887934 15:33704242-33704264 TGTCACCCAGGCTCCCAGGCTGG - Intronic
1125817846 15:42601577-42601599 TGCCCCCCCACCTCCCGGACGGG + Intronic
1129326540 15:74802925-74802947 TCCCCCCCACCCTCACGGGCAGG - Exonic
1130567965 15:85014174-85014196 TGTCCCCCAGGCTACCAGGCTGG + Intronic
1131343119 15:91621459-91621481 TGCCCACCAGGCTCAGGGGCAGG - Intergenic
1131785507 15:95907154-95907176 TTCCTCCAAGTCTCCCGGGCAGG - Intergenic
1132163622 15:99565293-99565315 TGCCGCCCGGAGTCCGGGGCCGG - Intergenic
1133015574 16:2938009-2938031 TGCAGCCCAGACTCCCACGCTGG - Intronic
1133026128 16:2989703-2989725 TGTCCCCCAGGCACCCTGGCTGG + Intergenic
1136778786 16:32884968-32884990 TGCCCCCCAGACTCCTGGGCTGG - Intergenic
1136891832 16:33976550-33976572 TGCCCCCCAGACTCCTGGGCTGG + Intergenic
1137396063 16:48116888-48116910 TGACCCCCATACTCCTGGCCTGG + Intronic
1137787696 16:51151746-51151768 CCCCCCCCACAATCCCGGGCTGG + Intergenic
1138313582 16:56049368-56049390 TGACCCCCATATTCCCTGGCAGG + Intergenic
1142132414 16:88437109-88437131 TGCCCTCCAGGCCTCCGGGCAGG - Exonic
1142453905 16:90204529-90204551 TGCCCCTCAGACTTCCAGGGAGG + Intergenic
1203081201 16_KI270728v1_random:1147057-1147079 TGCCCCCCAGACTCCTGGGCTGG - Intergenic
1143483391 17:7239445-7239467 TGCCTCCCGCACTCCCGGACCGG + Exonic
1145118318 17:20232399-20232421 TGCCCACCAGACTCACGGAGGGG - Exonic
1146126757 17:30237039-30237061 TGCCACCTAGACGCCAGGGCGGG + Intergenic
1147312592 17:39604244-39604266 TGCCCCCCGGACGCCGGCGCCGG + Intronic
1147330361 17:39695767-39695789 TGCCCCCCAGTCTCCATGGCTGG + Intronic
1147336400 17:39729106-39729128 TGCCCCCCACATTCCCAGACTGG + Intronic
1148338708 17:46860255-46860277 GGGCCGGCAGACTCCCGGGCTGG + Intronic
1152093426 17:78259001-78259023 TGCCACCCAGTCCCCCAGGCTGG - Intergenic
1152729045 17:81960985-81961007 TGCCCCCGACACCCCCGGCCCGG - Exonic
1152891172 17:82882412-82882434 TGTCCCCCAGCCTCCAGTGCTGG - Intronic
1155972277 18:32093030-32093052 CGCCCCTCAGAGTCCCGGGGCGG + Intronic
1156144589 18:34159773-34159795 TGCTCCCCAGACACCCGGGAAGG - Intronic
1156449265 18:37257727-37257749 TGACCCCCAGATTCTGGGGCTGG - Intronic
1156997150 18:43482269-43482291 AGCTCCCGAGGCTCCCGGGCAGG + Intergenic
1158015789 18:52782268-52782290 TGCCCTCTAGACTGCCAGGCAGG + Intronic
1159616677 18:70588062-70588084 TGTCCCCCAGGCTGCCAGGCTGG - Intergenic
1160174901 18:76585223-76585245 TGCCCCCCAAGCTCCGAGGCAGG + Intergenic
1160726143 19:618658-618680 TGCTCTCCAGACCCCCGGCCAGG + Intronic
1160851578 19:1195377-1195399 TGCCCTCCAGCCTGCAGGGCAGG - Intronic
1160852002 19:1197191-1197213 TGCCCTCCAGCCTGCAGGGCAGG - Intronic
1160996570 19:1884909-1884931 TGCCACCCTGACTCCTGGGCGGG - Intronic
1161269180 19:3380353-3380375 TGGCACCCAGGCTCCCAGGCTGG + Intronic
1161517087 19:4702602-4702624 TGCCCCACAGCCTCCTGGGAAGG - Exonic
1161752867 19:6110341-6110363 CGCCCCCCACACTCCCCGGCCGG + Intronic
1162022698 19:7874833-7874855 TGCCCCCCAGAGACCCTGGGCGG - Intergenic
1162067240 19:8133199-8133221 TGCCTCCCACACTCCAGGGAGGG - Intronic
1162461669 19:10817374-10817396 GGCCCCCCAAACTCGCCGGCAGG - Intronic
1162535923 19:11262668-11262690 CGGGCCCCAGACTCCCGGGCTGG + Intergenic
1162535957 19:11262782-11262804 GGTGCCCCAGACTCCCGAGCTGG + Intergenic
1162801382 19:13112663-13112685 TGTCCCCCGGTCTCCCTGGCTGG + Intronic
1163279547 19:16307157-16307179 TGCCCCTCAGGTTCCCAGGCCGG - Intergenic
1163501996 19:17681732-17681754 TGTCCCCCAGAGGCGCGGGCAGG + Intronic
1163572651 19:18091352-18091374 TGCCCCACAGACTCGGGGGCGGG + Intronic
1163700072 19:18782505-18782527 TGCCCCCCAGAATCCTGGGGCGG + Intergenic
1164692638 19:30222599-30222621 AGCCCCGCAGACGGCCGGGCAGG - Intergenic
1165949743 19:39467612-39467634 TGCCCCCCAGACTCCCTAGCTGG + Intronic
1167016124 19:46842271-46842293 AGCCCTCCAGACCCCCAGGCTGG + Intronic
1167883228 19:52479503-52479525 TGTCTCCCAGTCTCCCAGGCTGG - Intronic
1168213489 19:54908616-54908638 TGCCCCCCAACCTCCCGGACGGG + Intronic
1168294585 19:55372638-55372660 AGCCTCCGAGACTGCCGGGCTGG + Intergenic
1168347807 19:55659372-55659394 CGACCCCCCGACTCCCAGGCTGG - Intronic
1168702835 19:58451849-58451871 TGCGCCCATGACTGCCGGGCAGG + Intronic
925610563 2:5697486-5697508 CGCCCCCCAGCCTCCCGCTCTGG + Exonic
925627603 2:5856999-5857021 TGCCCCCCAAATTCCCTGACAGG + Intergenic
927690066 2:25202094-25202116 TGGCCCCCAGCCTCCTGGGCTGG + Intergenic
927940775 2:27101599-27101621 TGGCCCCCAGGCTCCTGGACAGG + Exonic
929160900 2:38831357-38831379 TGTCCCCCAGGCTGCCAGGCTGG + Intronic
933779041 2:85788733-85788755 TGCTGCTCAGACTCCTGGGCTGG + Intergenic
934527365 2:95059987-95060009 TGCCTCCCAGACACCATGGCTGG + Intergenic
934770857 2:96906966-96906988 TGCTCCCCTCACCCCCGGGCCGG - Intronic
934896849 2:98126969-98126991 CGCCCCCCACCCTCCCGGCCAGG + Intronic
935500796 2:103835886-103835908 TGTCCCCCAGGCCCCCAGGCTGG - Intergenic
936865364 2:117071647-117071669 TGCCACCAAGTCTCCCGGACGGG - Intergenic
937205071 2:120231116-120231138 TGCTCCTCAGACTCCCAGACTGG + Intergenic
937856213 2:126673644-126673666 TCCCCCACAGATTCCTGGGCAGG + Intronic
941979023 2:171434512-171434534 CGCGCCCCACACTCCCGTGCTGG - Exonic
942220678 2:173765974-173765996 TGTCACCCAGCCTCCCAGGCTGG - Intergenic
948890584 2:240905275-240905297 TGCCTCCCGGTCTCCTGGGCTGG + Intergenic
949085357 2:242149192-242149214 TGCCCCTCAGACTTCCAGGGAGG + Intergenic
1171293283 20:23994717-23994739 TGGCTTCCAGACTCCCCGGCTGG - Intergenic
1172870043 20:38130112-38130134 TGGGCCCCAGACCCCAGGGCAGG - Exonic
1173886427 20:46463215-46463237 TGCCACCCAGGCTCCCTGGCTGG - Intergenic
1173918685 20:46727905-46727927 TGCCCCCCAGCCTCCCAAGTTGG - Intronic
1174277479 20:49414430-49414452 TGCCCCTCAGCCTCTCAGGCAGG + Intronic
1174368257 20:50069320-50069342 TACCTACCAGACTCCAGGGCTGG + Intergenic
1174504020 20:51005072-51005094 TGCCCCTCAGACACCCAGGTGGG - Intronic
1175385825 20:58594525-58594547 TGCCCCCCTGCCTCCCAGCCAGG + Intergenic
1175818767 20:61897287-61897309 TGCCTCCCAGAGTCTCGGGATGG - Intronic
1175925874 20:62471109-62471131 TGGATCCCAGACTCCTGGGCTGG - Intronic
1176041866 20:63069942-63069964 TGCCCGCCAGTCCCCAGGGCGGG + Intergenic
1177331070 21:19663885-19663907 TGCCCCCCAGACTCTCTAGCTGG - Intergenic
1179492701 21:41751695-41751717 TGCCCGCCAGCCTCCCCAGCTGG - Intronic
1179544630 21:42105982-42106004 TGCCCGGCAGGGTCCCGGGCAGG + Intronic
1179718502 21:43302357-43302379 TGCCCCTCAGCCTCAGGGGCAGG - Intergenic
1180078939 21:45477657-45477679 CGCCCTCCAGAGTCCCAGGCTGG - Intronic
1180824344 22:18852432-18852454 TGGCTTCCAGACTCCCCGGCCGG - Intronic
1181037535 22:20177141-20177163 AGCCCCCCAGGCTCCAGGCCTGG - Intergenic
1181124770 22:20695586-20695608 TGGCTTCCAGACTCCCCGGCCGG - Intergenic
1181188390 22:21122116-21122138 TGGCTTCCAGACTCCCCGGCCGG + Intergenic
1181210808 22:21288377-21288399 TGGCTTCCAGACTCCCCGGCCGG - Intergenic
1181299238 22:21867633-21867655 TGCCTGCCAGACTGACGGGCGGG + Intronic
1181398701 22:22638511-22638533 TGGCTTCCAGACTCCCCGGCCGG + Intergenic
1181501432 22:23317867-23317889 TGGCTTCCAGACTCCCCGGCCGG + Exonic
1181650720 22:24257548-24257570 TGGCTTCCAGACTCCCCGGCTGG - Intergenic
1181706661 22:24653190-24653212 TGGCTTCCAGACTCCCCGGCCGG + Intergenic
1181814154 22:25424577-25424599 TGACCCACAGACTCCCTTGCAGG + Intergenic
1182861994 22:33568267-33568289 TGCCCACCAGTCTCCCGGGAGGG + Intronic
1183177221 22:36232979-36233001 TGACCCCCAGACCCCTGGGTCGG + Intronic
1183180608 22:36257558-36257580 TGACCCCCAGACCCCTGGGTCGG - Intronic
1183506481 22:38212027-38212049 TGTCACCCAGGCTCCCAGGCTGG + Intronic
1183546650 22:38457739-38457761 TGCACCCCACACTCCCAGGATGG - Intergenic
1184457098 22:44616908-44616930 TGCCTCCCTTCCTCCCGGGCTGG - Intergenic
1184521241 22:44995530-44995552 TGAGCCCCAGACTCCTGGGAGGG - Intronic
1184949832 22:47833397-47833419 TGCTTCCAAAACTCCCGGGCTGG + Intergenic
1185199675 22:49494045-49494067 GGCCCCCCAGCCTACAGGGCTGG - Intronic
1203216139 22_KI270731v1_random:7053-7075 TGGCTTCCAGACTCCCCGGCCGG + Intergenic
1203274482 22_KI270734v1_random:78336-78358 TGGCTTCCAGACTCCCCGGCCGG - Intergenic
951217726 3:20040497-20040519 TGCCCCGCAGCCGCCCGGCCCGG - Exonic
951473236 3:23078392-23078414 TGTCACCCAGGCTCCCAGGCTGG - Intergenic
953023897 3:39133923-39133945 TGTGCCCCAGACTCTGGGGCAGG - Intronic
953549001 3:43885966-43885988 TGCCCCCCAGTCACAGGGGCAGG + Intergenic
953575879 3:44112816-44112838 TGGCCCACAGAATCCCAGGCTGG - Intergenic
953907571 3:46875979-46876001 TGCCCCCCAGAGCCCTGGGCTGG + Intronic
954108732 3:48422718-48422740 TTCCCTCCAGACTCTGGGGCAGG + Intronic
955953807 3:64267940-64267962 TCCCCCGCAGTTTCCCGGGCCGG - Intronic
956484107 3:69703212-69703234 TGTCACCCAGGCTCCCAGGCTGG - Intergenic
956516958 3:70060345-70060367 TGCCTCCCAGACTCTCCTGCTGG - Intergenic
960577529 3:119242774-119242796 TGCCCCCCCACCTCCCGGGCGGG - Intergenic
960935994 3:122903056-122903078 TGCACCCCAGTTTCCAGGGCTGG - Intergenic
961755134 3:129122494-129122516 TGCCTCCCAGACCGCCGGTCAGG + Intronic
962006238 3:131352632-131352654 TGACCCCCAGCCTCCCAGCCAGG - Intergenic
962396545 3:135019337-135019359 TGGCCCCCAGAGTCCTGGGGTGG - Intronic
962688827 3:137872846-137872868 TGCCCCCCCACCTCCCGGACGGG - Intergenic
963615491 3:147531542-147531564 TGTCACCCAGACTCCCAGACTGG - Intergenic
966594302 3:181712290-181712312 GGCCCCCCAAAGTCCCGGCCGGG + Exonic
966847940 3:184144978-184145000 TGCCCTCCTGGCTCCTGGGCTGG + Exonic
967087480 3:186108471-186108493 TGCCCCCCAGAGCACCGGGAGGG - Intronic
968611021 4:1556994-1557016 GGCGGCCGAGACTCCCGGGCCGG + Intergenic
969466471 4:7360168-7360190 TGCCCCACAGAATACCGGGCAGG + Intronic
969553895 4:7893077-7893099 TGCCCCCCCGGCACCGGGGCTGG - Intronic
971313375 4:25546150-25546172 TATCCCCCAGACTTCAGGGCAGG - Intergenic
972391004 4:38613388-38613410 TGTGCACCAGACTCCAGGGCAGG - Intergenic
974870573 4:67637163-67637185 TGCCCCCCCACCTCCCGGACGGG - Intronic
979262789 4:118667440-118667462 TGCCCCTCAGACTTCCAGGGAGG + Intergenic
982274066 4:153622049-153622071 TGCCCCCCAGCCCCCCAGTCTGG + Intronic
984908387 4:184649768-184649790 TTCCCTCCAGAATCCCGCGCTGG - Exonic
985763042 5:1761455-1761477 TCCCCCTCAGACTCCCCCGCTGG + Intergenic
987321118 5:16770198-16770220 TGTCACCCAGGCTCCCAGGCTGG - Intronic
987335799 5:16896729-16896751 TGCACCCCAGAATCCTGGGGGGG - Intronic
987553781 5:19418224-19418246 TGCCACCCAGACTGGAGGGCTGG - Intergenic
988836340 5:35036155-35036177 TGCCCTCCAGACTCAGGGACTGG + Intronic
995539111 5:113167067-113167089 TGCCGACCAAACTCCCAGGCAGG - Intronic
995745805 5:115402259-115402281 TGCTCCCCAGGCTCTGGGGCTGG - Intergenic
1002505645 5:179677569-179677591 TGCCGCCCAGGCTGCCGTGCAGG - Intergenic
1002737494 5:181406075-181406097 TGCCCCTCAGACTTCCAGGGAGG + Intergenic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1003174385 6:3744450-3744472 TCCCCCCCACACTCCCGGGCAGG + Intronic
1005128098 6:22471899-22471921 TGCCTCCCAGACTCCTAAGCAGG + Intergenic
1006366877 6:33621276-33621298 GGCCTCCCCGCCTCCCGGGCGGG + Exonic
1006479770 6:34282656-34282678 TGCCCCCAAGCCTCCCAGCCAGG - Exonic
1006781476 6:36635373-36635395 TGGCACCCAGACCCCAGGGCGGG - Intergenic
1006955353 6:37865146-37865168 TGTCACCCAGTCTCCCAGGCTGG - Intronic
1008542592 6:52558168-52558190 TGCTCCCCAGAACCCCGGGGAGG - Intronic
1017744922 6:157437399-157437421 TGCTCCCGAGTGTCCCGGGCAGG + Intronic
1019242591 6:170681630-170681652 TGCCCCTCAGACTTCCAGGGAGG + Intergenic
1024944005 7:54790872-54790894 TGCCACACAGACACCCGGCCAGG + Intergenic
1026041248 7:66870024-66870046 TGTCACCCAGGCTCCCAGGCTGG + Intergenic
1029414373 7:100433777-100433799 TCTCCCCCAGCCTCCCAGGCTGG + Exonic
1029707268 7:102282591-102282613 CGAGCCCCAGACTCCGGGGCGGG - Intronic
1031980698 7:128122502-128122524 TGCCCCCCCCACCCCCCGGCCGG + Intergenic
1032757988 7:134909651-134909673 TGTCACCCAGGCTCCCAGGCTGG - Intronic
1035505529 8:126523-126545 TGCCCCTCAGACTTCCAGGGAGG - Intergenic
1039952314 8:42181814-42181836 TGCCTACCAGACTTCCAGGCTGG - Intronic
1041686824 8:60652210-60652232 CGCCTCGCAGACTCCGGGGCCGG + Intergenic
1042138175 8:65652140-65652162 TGCACCCCAGACTCCAGCCCGGG - Intronic
1044959103 8:97512569-97512591 TGCACCCCAGACTCAAGGGGAGG - Intergenic
1046736068 8:117777826-117777848 TGCCCCGCAGCCGCCCGGCCTGG + Intergenic
1047251215 8:123183094-123183116 TGTCCCCCAGACACCCTGGGAGG + Exonic
1048303523 8:133267816-133267838 TGCACCCCAGACTCCATAGCAGG + Intronic
1049113623 8:140666306-140666328 TGTCACCCAGGCTCCCAGGCTGG - Intronic
1049277687 8:141728126-141728148 CGCCTCTCGGACTCCCGGGCTGG - Intergenic
1049792082 8:144476770-144476792 TGCCCCCCACACCCCCGGTCGGG + Intergenic
1051287370 9:15510717-15510739 GGCCCCCTCGGCTCCCGGGCGGG + Intronic
1055933917 9:81587640-81587662 CACCTCCCAGACTCCAGGGCAGG + Intronic
1056718483 9:89053527-89053549 TCTCTCCCAGACTCCAGGGCAGG + Intronic
1057149480 9:92783663-92783685 TGTCCCTCACACTCCCAGGCTGG + Intergenic
1061169423 9:128943604-128943626 TGCCCCACGGACTCCCAGGGTGG - Intronic
1061727612 9:132590100-132590122 TGCCCTCCCCACTCCCAGGCGGG + Exonic
1061828424 9:133275507-133275529 TGACACCCTGTCTCCCGGGCGGG + Intergenic
1061861881 9:133472497-133472519 TGCCCACCAGGCTGCAGGGCGGG - Intronic
1061912531 9:133732601-133732623 TGGCACCCACCCTCCCGGGCAGG - Exonic
1062332574 9:136051149-136051171 TCCCCCTGAGCCTCCCGGGCAGG + Intronic
1203602782 Un_KI270748v1:30854-30876 TGCCCCTCAGACTTCCAGGGAGG + Intergenic
1190053956 X:47171264-47171286 TGCCCCCCATGGCCCCGGGCAGG + Intronic
1190228443 X:48563174-48563196 CTCCCTCCAGACACCCGGGCTGG + Intergenic
1197455715 X:126674110-126674132 TGCCCCCCCACCTCCCGGACGGG - Intergenic
1198106630 X:133468226-133468248 TCCACCGCAGACTCCAGGGCTGG - Intergenic
1200002132 X:153067514-153067536 GGCCCCCCCGACCCCGGGGCTGG - Intergenic
1200005601 X:153082511-153082533 GGCCCCCCCGACCCCGGGGCTGG + Intergenic
1200101020 X:153689073-153689095 TGCCCCCCAGACTCCCGGGCTGG + Intronic
1200218471 X:154379136-154379158 CACCGCCCTGACTCCCGGGCGGG + Intergenic
1202384854 Y:24315899-24315921 TGCCCCTCAGACTTCCAGGGAGG + Intergenic
1202485931 Y:25354223-25354245 TGCCCCTCAGACTTCCAGGGAGG - Intergenic