ID: 1200102225

View in Genome Browser
Species Human (GRCh38)
Location X:153693894-153693916
Sequence CTTTCCCACAGGGCCGGGCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 507
Summary {0: 4, 1: 1, 2: 2, 3: 46, 4: 454}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200102225 Original CRISPR CTTTCCCACAGGGCCGGGCC TGG Exonic
900163866 1:1237005-1237027 CTTTCCCTCAGGGCCAGGGTGGG + Intergenic
900289780 1:1918996-1919018 CCTCCCCATAGGGCGGGGCCAGG + Intronic
900428895 1:2592766-2592788 CTCTCCCTCAGGGCCAGGGCTGG + Intronic
900687116 1:3955642-3955664 CTTTCCCACAGGCCATGCCCTGG + Intergenic
901131144 1:6963007-6963029 GTCTGCCACAGGGCGGGGCCAGG - Intronic
901654819 1:10763160-10763182 CTTTCCCACAGCCCAGGCCCCGG + Intronic
901897818 1:12329558-12329580 CCTTCCCACAGTGCCAGCCCTGG - Intronic
903845978 1:26280215-26280237 CTTTCCCCCAGCGCCAGTCCGGG - Intronic
904205745 1:28854176-28854198 CTTTCCCACAGTGCCATCCCGGG - Intronic
904384861 1:30134600-30134622 CTTCTCCCCAGGGCCGGGCCAGG - Intergenic
905263549 1:36735632-36735654 CTTACCCCCAGGGCAGGCCCTGG - Intergenic
905300128 1:36981297-36981319 CATTGCCACAGGGCTGGGCTGGG + Intronic
905375658 1:37518480-37518502 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
905629015 1:39508506-39508528 GTTGCCCACAGGGTCGGGACTGG + Intronic
905742920 1:40388081-40388103 CCTTCCCACGGGGCAGGGCTCGG + Intronic
905797290 1:40822906-40822928 CTGCCCCACTGGCCCGGGCCAGG + Intronic
906083194 1:43107644-43107666 CCTCCCCACAGGGCAGGGCTCGG - Intergenic
906563490 1:46778650-46778672 CCTTCCCACAGGGCAGGGCTCGG - Intronic
907283149 1:53363638-53363660 GTTTCCCACAGGGCCCTGGCAGG - Intergenic
907759484 1:57343581-57343603 CCTTCCCTCAGGGCAGGGCTCGG - Intronic
908291367 1:62670118-62670140 CCTTCCCACGGGGCAGGGCTCGG + Intronic
912312853 1:108641001-108641023 CCTTCCCGCAGGGCAGGGCTCGG - Intronic
912518573 1:110230582-110230604 CCCTCCCACAGGGCTGGGTCTGG + Intronic
914438415 1:147680898-147680920 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
914751160 1:150535957-150535979 TTTCCCCACAGGGCCTGGCATGG - Intergenic
915260080 1:154670979-154671001 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
916939050 1:169661402-169661424 CCTTCCCACGGGGCAGGGCTTGG + Intergenic
916940087 1:169668240-169668262 CCTTCCCACGGGGCAGGGCTTGG + Intronic
918659739 1:187073948-187073970 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
921055459 1:211539275-211539297 GTTTCCCACTGGGCCTGTCCTGG + Intergenic
921801834 1:219410880-219410902 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
921903808 1:220475801-220475823 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
921983646 1:221285790-221285812 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
922056852 1:222049974-222049996 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
922985905 1:229865684-229865706 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
923149534 1:231220856-231220878 CTTTACCCGAGGGCCTGGCCTGG - Intronic
924051251 1:240081684-240081706 CGTTCCAACAGGGCAGGGCATGG + Intronic
924266198 1:242284764-242284786 CTTCCCCACAGGACATGGCCAGG + Intronic
1062858435 10:791235-791257 CCTGAGCACAGGGCCGGGCCTGG + Intergenic
1066234069 10:33468262-33468284 CCTTCCCACAGGGCAGGGCTCGG + Intergenic
1066293645 10:34035615-34035637 CCTCCCCACAGGGCAGGGCTCGG + Intergenic
1066567373 10:36734751-36734773 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1066718634 10:38313796-38313818 CTTCCCCACAGGACATGGCCAGG - Intergenic
1067679181 10:48416821-48416843 CTCTCCCACAGGGTAGAGCCAGG - Intronic
1068337030 10:55647367-55647389 CATTCCCACATGGCCAGGCATGG + Intergenic
1068374050 10:56155351-56155373 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1069186498 10:65429540-65429562 CCTTCCCACCGGGCAGGGCTCGG - Intergenic
1069716258 10:70523270-70523292 CGTCCCCACAGGGCTGGGCTCGG - Intronic
1069961909 10:72084158-72084180 CTTTCTCACAGGGACAGGCATGG + Intronic
1070826609 10:79393916-79393938 CCCTCCCACATGCCCGGGCCTGG + Intronic
1071003785 10:80859482-80859504 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1071037454 10:81265046-81265068 CCTTCCCACAGGGCAGGGCTGGG - Intergenic
1071041068 10:81309207-81309229 CCTTCCCACAGGGCAGGACTCGG - Intergenic
1073295058 10:102433835-102433857 CTTCCCCACAGGGCAGCACCGGG - Intergenic
1075255648 10:120924053-120924075 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1075722927 10:124597926-124597948 CTTTGGCAGAGGGACGGGCCTGG - Intronic
1076250628 10:128981307-128981329 TGTTCACACAGGGCCGGCCCAGG + Intergenic
1076692605 10:132231330-132231352 TCCTCCCACAGGGCCAGGCCAGG - Intronic
1077234131 11:1471845-1471867 CTCTCCCAAAGGGTGGGGCCTGG - Intronic
1077519020 11:3020220-3020242 CTTTCCCCAAGGGCACGGCCAGG + Exonic
1078143471 11:8707842-8707864 CTTTCCCACTTGGCTGGGCCAGG + Exonic
1078251874 11:9623167-9623189 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1078843969 11:15105376-15105398 CTTTCCCACTGGGACCTGCCTGG + Intergenic
1079555400 11:21753273-21753295 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1081125089 11:39312061-39312083 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1081815171 11:45935083-45935105 CTTTCCCACTTGGACAGGCCGGG + Intronic
1081995401 11:47360485-47360507 CTTTCCCTGAGGGCCGGCTCTGG - Intronic
1082912304 11:58390703-58390725 CTTCCCCACGGGGCAGGGCTGGG - Intergenic
1083171181 11:60924768-60924790 CGCTCCCACTCGGCCGGGCCCGG - Intronic
1083617148 11:64031944-64031966 CTTCCCCACAGGCCCCAGCCTGG - Intronic
1084170863 11:67400452-67400474 CTTTCCCCCAGGGCCCTGCCTGG - Intronic
1084441024 11:69173462-69173484 CTTGCCCAGAGGGCTGGGCCAGG - Intergenic
1084500687 11:69533513-69533535 CATTCTCACACGGCCTGGCCAGG - Intergenic
1084610844 11:70202215-70202237 CTTTACCACAGGGTGGGGCAGGG - Intergenic
1085121523 11:73970379-73970401 CTTTCCCACAAAGCCAGGACAGG - Intergenic
1085512788 11:77096760-77096782 CTGAGCCACAGAGCCGGGCCTGG + Intronic
1085530133 11:77187590-77187612 CTTCCCCACAGGGCCAGGAGAGG + Intronic
1086043059 11:82501387-82501409 CCTTCCCACAGGGCAGGCCTCGG + Intergenic
1087682324 11:101231467-101231489 CCTCCCCACAGGGCAGGGCTCGG - Intergenic
1088232945 11:107691587-107691609 ACTTGCCACAGGGCAGGGCCAGG - Intergenic
1088268450 11:108009413-108009435 CTTTCCCAAAGAGCCGAACCCGG - Intronic
1089762619 11:120739405-120739427 CATTCCCACAGGTCTGAGCCTGG + Intronic
1090279386 11:125443024-125443046 CTCCACCACAGGGCCGGGCGTGG - Intergenic
1090820507 11:130337535-130337557 CCTCCCCACAGGGCAGGGCTCGG - Intergenic
1091145076 11:133272567-133272589 CTTCCCCTCTGGGCCGGCCCGGG + Intronic
1092364081 12:7862414-7862436 CCTTCCCACGGGGCAGGGCTCGG + Intronic
1093972985 12:25391657-25391679 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1094448750 12:30561862-30561884 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1094589276 12:31805921-31805943 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1094635802 12:32226628-32226650 GCATCCCACAGGGCCAGGCCAGG + Intronic
1094666512 12:32525902-32525924 CCTTCCCACGGGGCAGGGCTCGG + Intronic
1096136318 12:49204650-49204672 CCTTCCCACAGGGCCCTACCTGG + Intronic
1100584720 12:95969363-95969385 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1100631689 12:96395906-96395928 TTTTCTCACAGGTCCGGGGCTGG - Intronic
1100769491 12:97905930-97905952 GTCTCACACTGGGCCGGGCCTGG - Intergenic
1102976379 12:117209782-117209804 CTTTGCCACAAGGCAGGGACTGG + Exonic
1103239083 12:119398172-119398194 CCTCCCCACAGGGCAGGGCTCGG - Intronic
1103253401 12:119520342-119520364 CTTTACTGCAGGGCCGGGCGTGG + Intronic
1103254467 12:119529021-119529043 CTGTCCCACAGGGCCTGGCAAGG - Intronic
1103853315 12:123947189-123947211 CCTTCCCGCAGGGCAGGGCTCGG + Intronic
1103898748 12:124292280-124292302 CCTTCCTACAGCGCTGGGCCTGG + Intronic
1103902388 12:124310216-124310238 ATTTCACTCAGGGCAGGGCCAGG - Intronic
1105514330 13:21076499-21076521 CCTTCTCACAGGGCCTGGCTGGG - Intergenic
1105595530 13:21834146-21834168 TTTTCCCAGAGGGCCTGGCCTGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1107804574 13:44141997-44142019 CTCTCCCACAAGGCCGAGCGCGG + Intergenic
1107867393 13:44716051-44716073 CTTTCCCACAGGGTTGGGCAAGG + Intergenic
1108362280 13:49678441-49678463 CTTCCCCACGGGGCAGGGCTCGG - Intronic
1108469434 13:50753439-50753461 CCTTCCCACGGGGCAGGGCTCGG - Intronic
1109159849 13:58958314-58958336 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1109741544 13:66561249-66561271 CCTTCCCACAGGGCAGGGCTCGG + Intronic
1110301840 13:73937692-73937714 CTTTCCCTCAGGGCCTGCCCTGG - Intronic
1110368893 13:74718617-74718639 CTTTCCCACGGGGCAGGGCTCGG + Intergenic
1110792373 13:79600290-79600312 CTTTCCCACGGGGCAGGGCTCGG - Intergenic
1111748350 13:92296894-92296916 CCTTCCCGCAGGGCAGGGCTCGG + Intronic
1111979693 13:95003109-95003131 CTCTGCCACAGAGCTGGGCCTGG - Intergenic
1112304491 13:98261331-98261353 CTTTCCCCCAAGGATGGGCCAGG - Intronic
1113627909 13:111859832-111859854 CATAGCCACAGGGCAGGGCCAGG - Intergenic
1113932151 13:113974209-113974231 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1113932179 13:113974303-113974325 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1113932207 13:113974397-113974419 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1113932221 13:113974444-113974466 CTTTCCCGCAGGCCGGGGCTGGG + Intergenic
1114353962 14:21886974-21886996 CTTTACCTCAGTGCCGGGCTTGG + Intergenic
1114627042 14:24136599-24136621 CTTTCCCTCAGGGAGGGTCCCGG + Intronic
1115533222 14:34345939-34345961 CTTCCCCACAGGGCAGAGCTTGG - Intronic
1116325829 14:43533258-43533280 CCTCCCCACAGGGCAGGTCCTGG + Intergenic
1118589858 14:67393121-67393143 CTGTCCCCCAGGGCCGGGCTGGG - Intronic
1118658248 14:67977560-67977582 CTTTGCCAAAGGGCTTGGCCAGG - Intronic
1119174496 14:72559380-72559402 CTTCCCCAAAGCCCCGGGCCAGG + Intronic
1119185785 14:72641519-72641541 CTTGCCCACAAGGCTGGGGCAGG + Intronic
1119220952 14:72907010-72907032 CTTTTCCACAAGGCAGGGCAGGG - Intergenic
1120214648 14:81668843-81668865 CCTCCCCACAGGGCAGGGCTGGG - Intergenic
1120844188 14:89111876-89111898 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1121180148 14:91922803-91922825 ATTTCTCACAGGACCAGGCCAGG + Intronic
1121450257 14:94002475-94002497 CTATCCCACAGGGCCTGGCCAGG + Intergenic
1122076231 14:99236727-99236749 CTTCAGCACAGGGCCTGGCCCGG + Intronic
1122640131 14:103155149-103155171 CCTTCCCTGAGGGCCGGGCTGGG + Intergenic
1124061564 15:26298194-26298216 CCTCCCCACAGGGCAGGGCTCGG - Intergenic
1124360934 15:29036044-29036066 CTTTGGCTCAGGGCTGGGCCCGG + Intronic
1124573151 15:30883985-30884007 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1125724833 15:41862870-41862892 CTTTCCCACAGTCCAGGGCCTGG + Exonic
1126165509 15:45651138-45651160 CCTCCCCACAGGGCAGGGCTTGG - Intronic
1127588331 15:60398190-60398212 CTTTCTCGGAGGGCAGGGCCAGG - Intronic
1128318949 15:66679410-66679432 ACTTCCCACTGGGCCTGGCCAGG - Intronic
1128475849 15:67996288-67996310 CTTTCCCCAAGGGCCAGACCAGG + Intergenic
1128866278 15:71117060-71117082 ATTTCCCAGAGGTCTGGGCCTGG + Intronic
1129269813 15:74413664-74413686 ATTTCCCACAGGGCAGGGCCTGG - Intronic
1129373991 15:75116128-75116150 CCTTCCCACGGGGCAGGGCTCGG - Intronic
1129687608 15:77695595-77695617 CTGGCCCACAGGGCCTGACCTGG - Intronic
1130564616 15:84982407-84982429 CTTTCCCGCAGGGGCCGGGCGGG + Intronic
1131094214 15:89645737-89645759 CTCTCCCCCAGGGGCTGGCCAGG + Intronic
1131250267 15:90825698-90825720 CTTCCCCGCAGGGCAGGGCTTGG + Intergenic
1131762393 15:95638503-95638525 TTTTACCTCAGGGCCGGGCGCGG - Intergenic
1131992365 15:98104398-98104420 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1132672090 16:1106165-1106187 CTGCCCCTCAGGGCCTGGCCTGG - Intergenic
1132686888 16:1165913-1165935 TTGCCCCACACGGCCGGGCCGGG - Intronic
1132696378 16:1203999-1204021 CTCTCCCGCAGGACTGGGCCAGG + Exonic
1132792510 16:1699685-1699707 CTTTCACACAGGGCTGGTCTTGG + Exonic
1132991444 16:2797557-2797579 ATTTCACACAAGGCCGGGCGTGG - Intergenic
1133052314 16:3124207-3124229 CTTCGCTACACGGCCGGGCCCGG - Intergenic
1134794743 16:17024636-17024658 GATACCCACAGGGCCGGGCACGG - Intergenic
1136078872 16:27838630-27838652 CCTCCCCACTGGGCAGGGCCTGG - Intronic
1136552520 16:30989284-30989306 CCGTCCCACAGGGCCTGACCTGG + Exonic
1136777621 16:32880148-32880170 CTTTCCCACAGGGCCGGGCCTGG - Intergenic
1136893003 16:33981366-33981388 CTTTCCCACAGGGCCGGGCCTGG + Intergenic
1138108590 16:54305418-54305440 CTCTCACACAGGGCCTGGCTGGG + Intergenic
1139095838 16:63703768-63703790 CTTTCCCCTGGGGCGGGGCCTGG + Intergenic
1140649991 16:77077408-77077430 CCTCCCCACAGGGCAGGGCTGGG + Intergenic
1140929241 16:79611684-79611706 CTTTGCCACAGGGGTGGGCTCGG - Intergenic
1141660007 16:85436661-85436683 CTTGCCCAGTTGGCCGGGCCTGG - Intergenic
1203080036 16_KI270728v1_random:1142257-1142279 CTTTCCCACAGGGCCGGGCCTGG - Intergenic
1142505692 17:361822-361844 CCTTCCCACGGGGCAGGGCTCGG + Intronic
1142749735 17:1979985-1980007 CTTTCCCACACACCCTGGCCTGG + Intronic
1143283376 17:5771429-5771451 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1144683447 17:17210629-17210651 CTTACACTCAGGGCCGGGCATGG - Intronic
1145878282 17:28335922-28335944 TTTTCCCCCAGGACCCGGCCGGG - Intronic
1146277632 17:31525275-31525297 CTATCCCACAGGGCTGCCCCAGG - Intronic
1147685507 17:42284555-42284577 TTATCCCAAAGGGCCGGGCATGG - Intergenic
1148271702 17:46266809-46266831 CGCTCCCACAGGCCCGCGCCTGG + Intergenic
1148891209 17:50808681-50808703 CGGTCCCACAGGGGCTGGCCGGG + Intergenic
1148913310 17:50954872-50954894 CTTTCCTTCAGGGCCCGGCCGGG - Intergenic
1149549961 17:57532864-57532886 CTGCCCCACAGGGCTGGGCTAGG - Intronic
1149705504 17:58691376-58691398 ATTGCCAACAGGGCCGGGCGCGG + Intronic
1149854069 17:60064017-60064039 CTGTCCCACTGGGCCGGGTGCGG + Intronic
1152007317 17:77690830-77690852 CTTCCCGGCAGGGCCGGTCCTGG + Intergenic
1152454374 17:80404821-80404843 CTTTCCCACAGGGTCTGGGAAGG + Intergenic
1155208023 18:23577761-23577783 CCTTCCCACGGGGCAGGGCTCGG - Intronic
1155941931 18:31808662-31808684 CTTTCCCACAGGGTCGGAGAAGG + Intergenic
1155976794 18:32140051-32140073 CCTTCCCACAGGGCAGGGCTGGG + Intronic
1156863679 18:41865986-41866008 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1157819223 18:50753289-50753311 CTGTCCCCCAGGGCCTGGCTGGG + Intergenic
1157858358 18:51121093-51121115 CCTCCCCACAGGGCAGGGCTCGG - Intergenic
1158697235 18:59714224-59714246 CTTTCCCGCGGGGCAGGGCTCGG - Intergenic
1159941070 18:74409110-74409132 CTTTCACAGAGGGCATGGCCTGG + Intergenic
1160176597 18:76600261-76600283 CCTTCCCACAGGGCAGGCCTCGG - Intergenic
1161258020 19:3320491-3320513 GTTTCCCGGAGCGCCGGGCCGGG + Intergenic
1161456130 19:4370526-4370548 CTCTCCCACAGGGCCCCACCTGG + Intronic
1162233086 19:9283585-9283607 CCTTCCCACGGGGCAGGGCTTGG - Intergenic
1162420411 19:10562897-10562919 GAATCCCACAGGGCAGGGCCAGG + Intronic
1162632678 19:11941427-11941449 CCTTCCCACGGGGCAGGGCTCGG - Intronic
1162797607 19:13094977-13094999 CTTCCCCAGAAGGCCGGGGCGGG - Exonic
1162811120 19:13164729-13164751 CCTTCCCACAAGGCGGGACCTGG - Intergenic
1163600735 19:18247772-18247794 GTGTCCCACAGGGCCGTACCTGG - Intronic
1164975821 19:32571814-32571836 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1165300630 19:34966300-34966322 CTTTCCCTCTAGGCCGGGCATGG + Intergenic
1166649698 19:44563336-44563358 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1167037474 19:47002729-47002751 CGTTCACACAGGGACGGCCCAGG - Exonic
1168260415 19:55190783-55190805 CTTTCAGACAGGGCCAGGCATGG - Intronic
925111531 2:1342381-1342403 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111550 2:1342494-1342516 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111571 2:1342608-1342630 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111591 2:1342722-1342744 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111610 2:1342836-1342858 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111630 2:1342950-1342972 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111650 2:1343064-1343086 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111670 2:1343178-1343200 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111689 2:1343291-1343313 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111710 2:1343405-1343427 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111730 2:1343519-1343541 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111749 2:1343632-1343654 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111768 2:1343745-1343767 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111786 2:1343858-1343880 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111805 2:1343971-1343993 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111825 2:1344085-1344107 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111844 2:1344198-1344220 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111863 2:1344311-1344333 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111882 2:1344424-1344446 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111900 2:1344537-1344559 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111919 2:1344650-1344672 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111939 2:1344764-1344786 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111958 2:1344877-1344899 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111978 2:1344991-1345013 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925111996 2:1345104-1345126 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925112016 2:1345218-1345240 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925112036 2:1345331-1345353 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925112055 2:1345445-1345467 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925112076 2:1345559-1345581 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925112096 2:1345672-1345694 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925112117 2:1345785-1345807 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925112137 2:1345898-1345920 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925112157 2:1346012-1346034 CTGTCCTACAGAGCTGGGCCAGG - Intronic
925112178 2:1346126-1346148 CTGTCCTACAGAGCTGGGCCAGG - Intronic
927191539 2:20520266-20520288 CTCTCCCACAGGGATGGGGCAGG + Intergenic
928723100 2:34142667-34142689 CCTCCCCACAGGGCAGGGCTCGG - Intergenic
929109880 2:38397491-38397513 CCTCCCCACAGGGCAGGGCTGGG + Intergenic
929229076 2:39540653-39540675 CTTACCCACAAGGCAGGGCAAGG - Intergenic
929233733 2:39585584-39585606 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
929760455 2:44802095-44802117 CTATCCCCCAGGACTGGGCCCGG - Intergenic
932084572 2:68746714-68746736 CATCCCCACAGGGCCGGGCGCGG + Intronic
932486502 2:72087110-72087132 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
932776152 2:74529602-74529624 GCTTCCCTCAGGGCCGGGGCCGG - Exonic
933506336 2:83181228-83181250 CTTCCCCACAGGGCAGGGCTTGG + Intergenic
933712142 2:85334544-85334566 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
934873037 2:97885476-97885498 CTTTCACAAACGGCCGGGCGCGG - Intronic
936273675 2:111071864-111071886 GTTCCCCACAGGGCCTAGCCTGG - Intronic
937209573 2:120259882-120259904 CCTTCCCACGGGGCAGGGCTTGG - Intronic
937596871 2:123684002-123684024 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
938263426 2:129910741-129910763 CATCTCCACAGGGCCAGGCCTGG - Intergenic
939460375 2:142490758-142490780 CTTTCCCACAGGGTCTGGGAAGG - Intergenic
940215109 2:151296185-151296207 CCTTCCCACGGGGCACGGCCCGG + Intergenic
940337368 2:152543413-152543435 CAGGCCCACAGGGCCGTGCCAGG - Intronic
941397907 2:164994886-164994908 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
941705847 2:168657570-168657592 CCTTCCCACGGGGCAGGGCTCGG - Intronic
941925284 2:170888228-170888250 CTTTCCCCCAGGGCTGGGGGTGG + Intergenic
941933528 2:170965540-170965562 GTTTCCCCCAGTGCTGGGCCAGG + Intronic
943024231 2:182608633-182608655 CCTCCCCACAGGGCAGGGCTCGG + Intergenic
944729658 2:202503599-202503621 CCTTCCCACAGGGCAGGGCTCGG + Intronic
945575453 2:211524509-211524531 CCTTCCCACGGGGCAGGGCTCGG - Intronic
947720445 2:232366569-232366591 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
948931354 2:241134466-241134488 CTTCCCCACAGGGTCTCGCCTGG - Intronic
949004319 2:241636887-241636909 TTTCCCCGCAGGGCCGGGTCGGG + Intronic
1168892747 20:1305568-1305590 CTGTCCCACAGACCTGGGCCTGG - Exonic
1168975928 20:1965916-1965938 CCTGCCCAGAGGGCGGGGCCGGG + Intergenic
1169138092 20:3209747-3209769 CTTTTCCACACAGCCGGGTCAGG - Intronic
1169814430 20:9641720-9641742 CCTTCCCACGGGGCAGGGCTTGG - Intronic
1170384704 20:15803609-15803631 ATTTCCCACAGTGCAAGGCCTGG + Intronic
1172991286 20:39038844-39038866 GTTTCCCATAGAGCTGGGCCAGG - Exonic
1173348023 20:42218796-42218818 TTGTCCCACACAGCCGGGCCAGG - Intronic
1173401687 20:42731560-42731582 CCTTCACACAGTGCTGGGCCTGG - Intronic
1173464018 20:43267209-43267231 CTTTCCCAGTGGGCTGGGCCTGG + Intergenic
1174897663 20:54468127-54468149 CTTTCCCACAGGGACAGACAGGG + Intergenic
1175210090 20:57348625-57348647 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1175228696 20:57460257-57460279 ATTTCCCACAGGGAAGTGCCGGG - Intergenic
1175858071 20:62133429-62133451 ACTTCCCACAGGGCCGGGACTGG + Exonic
1176105680 20:63384728-63384750 TGTTCCCACAGGGCCGGGAGAGG + Intergenic
1176296731 21:5076952-5076974 CGTTCCCAAAGGGCAGGGCCTGG + Intergenic
1176332279 21:5559781-5559803 CCATCCCACAGGGCAGGGCTTGG - Intergenic
1176395478 21:6261170-6261192 CCATCCCACAGGGCAGGGCTTGG + Intergenic
1176441679 21:6727934-6727956 CCATCCCACAGGGCAGGGCTTGG - Intergenic
1176465941 21:7055003-7055025 CCATCCCACAGGGCAGGGCTTGG - Intronic
1176489502 21:7436781-7436803 CCATCCCACAGGGCAGGGCTTGG - Intergenic
1179496917 21:41778071-41778093 CCTTGTCACAGGGCCCGGCCTGG - Intergenic
1179568114 21:42261652-42261674 CTTCCCGAGGGGGCCGGGCCAGG - Intronic
1179860318 21:44185169-44185191 CGTTCCCAAAGGGCAGGGCCTGG - Intergenic
1180193761 21:46181772-46181794 GCTTCCCACCGGGCCGGGCCCGG - Intronic
1180824705 22:18854521-18854543 CTGTCTCCCAGGGCCAGGCCTGG + Intronic
1181125124 22:20697672-20697694 CTGTCTCCCAGGGCCAGGCCTGG + Intergenic
1181188025 22:21120026-21120048 CTGTCTCCCAGGGCCAGGCCTGG - Intergenic
1181211173 22:21290467-21290489 CTGTCTCCCAGGGCCAGGCCTGG + Intergenic
1181398331 22:22636421-22636443 CTGTCTCCCAGGGCCAGGCCTGG - Intergenic
1181501069 22:23315784-23315806 CTGTCTCCCAGGGCCAGGCCTGG - Exonic
1181706297 22:24651100-24651122 CTGTCTCCCAGGGCCAGGCCTGG - Intergenic
1181800872 22:25347062-25347084 CCTCCCCACAGGGCAGGGCTCGG - Intergenic
1182097295 22:27634669-27634691 AGTTCCCACAGGGCATGGCCGGG - Intergenic
1182366398 22:29782258-29782280 CTTGCCCACAGGGACCGGGCTGG - Intergenic
1182923658 22:34103005-34103027 ATGTCCCTCAGGGCCGGGCGCGG + Intergenic
1183393383 22:37558764-37558786 CTTTCCCTGGGGGCCGGCCCAGG - Intergenic
1183422096 22:37717971-37717993 CCTTCCCACCGGGCAGGGCTCGG - Intronic
1184339788 22:43880003-43880025 CATTTCCTCAGGGCCTGGCCGGG + Exonic
1184608036 22:45585637-45585659 CTTTCCCAGGGTGCTGGGCCCGG + Intronic
1185065107 22:48628217-48628239 CTTCTCCACAGGCCCAGGCCAGG + Intronic
1185101920 22:48845188-48845210 CTTTCCCACAGGGGTTGGCTAGG - Intronic
1203215775 22_KI270731v1_random:4964-4986 CTGTCTCCCAGGGCCAGGCCTGG - Intergenic
1203274851 22_KI270734v1_random:80427-80449 CTGTCTCCCAGGGCCAGGCCTGG + Intergenic
950038276 3:9902794-9902816 CTTTCGGGCAGGGCGGGGCCAGG + Intronic
950530212 3:13548862-13548884 GCTGCCCACAGGGCAGGGCCAGG - Intergenic
950553768 3:13682862-13682884 CTGTCCCACCGGGCTGGGGCAGG + Intergenic
952426000 3:33174886-33174908 CTTTCCCACAGGCCTGCACCAGG + Exonic
952867208 3:37862048-37862070 CTCTCCCAGAGCGCGGGGCCGGG + Intronic
953089852 3:39713544-39713566 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
954041026 3:47887435-47887457 CTTTCCCGCGGGGCAGGGCTCGG + Intronic
954674265 3:52307059-52307081 CTTTCACACCAGGCCAGGCCAGG - Intergenic
955353916 3:58214981-58215003 CTTCCACACAGGGCTGTGCCTGG + Intergenic
956989259 3:74744368-74744390 CTTTCCCACAAGGCAGTGCCTGG - Intergenic
957074099 3:75587985-75588007 CCTCCCCACAGGGCAGGGCTTGG + Intergenic
957362102 3:79173553-79173575 CCTTCCCACAGGGCAGGGCTGGG + Intronic
957446142 3:80314679-80314701 CCTCCCCACAGGGCAGGGCTCGG + Intergenic
957995129 3:87679327-87679349 CCTTCCCACGGGGCAGGGCTAGG + Intergenic
961572835 3:127812752-127812774 CTTTCCCACATGGCTGGTGCAGG - Intronic
962758273 3:138484878-138484900 CCTTCCCACAGGGCAGGGCTCGG + Intergenic
964014405 3:151928384-151928406 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
965044109 3:163552453-163552475 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
965744199 3:171907198-171907220 CCTCCCCACAGGGCAGGGCTCGG - Intronic
965837394 3:172867011-172867033 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
966381354 3:179347920-179347942 CTTTCCCACAGGACCGCGGCGGG - Intronic
966725028 3:183101126-183101148 CCTTCCCACGGGGCAGGGCTCGG + Intronic
966938210 3:184728181-184728203 TTTTACCACAGGGCCGGGCGCGG - Intergenic
967974117 3:195021883-195021905 CCTTCCAACAGGGGCAGGCCTGG + Intergenic
968083581 3:195863819-195863841 CTGTCACCCAGGGCAGGGCCTGG + Exonic
968519591 4:1029509-1029531 CGTACCCAAAGGGCCTGGCCTGG - Intergenic
968547113 4:1205099-1205121 CTTAGCCACAGGGACAGGCCAGG - Intronic
968799641 4:2733563-2733585 CTTCCCCATAGGGCGAGGCCCGG - Intergenic
968971410 4:3797659-3797681 CCATCCCACAGGGCAGAGCCCGG - Intergenic
969337063 4:6517245-6517267 CTTTCACACAGGGCAGGTGCCGG - Intronic
969621996 4:8283350-8283372 TCTTCCCACAGGGCCTGCCCCGG + Intronic
970272135 4:14358849-14358871 CCTTCCCGCAGGGCAGGGCTTGG + Intergenic
971220125 4:24697698-24697720 CTTTACCACAGGGATGTGCCAGG + Intergenic
971281660 4:25246755-25246777 CCTCCCCACAGGGCAGGGCTCGG - Intronic
971553015 4:27978466-27978488 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
973854124 4:54993699-54993721 CCTCCCCACAGGGCAGGGCTCGG + Intergenic
973867098 4:55125222-55125244 CTTACCCACAGAGGCGGCCCGGG + Exonic
975595165 4:76043426-76043448 CCTTCCTACAGGGCAGGGCTCGG - Intronic
975795128 4:77998717-77998739 CTGGCTCAGAGGGCCGGGCCGGG - Intergenic
976646846 4:87396077-87396099 CCTTCCCACAGGGCAGGGCTCGG - Intergenic
976980271 4:91218101-91218123 CCTTCCCACGGGGCAGGGCTCGG - Intronic
978917961 4:114148717-114148739 CCTCCCCACAGGGCAGGGCTTGG - Intergenic
979308346 4:119174015-119174037 CCTTCCCGCAGGGCAGGGCTTGG + Intronic
979762839 4:124428048-124428070 CTTTCCCAGTGGGCTGTGCCTGG - Intergenic
979865244 4:125745221-125745243 CCTCCCCACAGGGCAGGGCTTGG + Intergenic
979991487 4:127380164-127380186 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
980228004 4:130013010-130013032 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
980815579 4:137942300-137942322 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
982863403 4:160481989-160482011 CTTCCCCACGGGGCAGGGCTCGG + Intergenic
984041011 4:174733761-174733783 CTTTCCCACATGGCCCTGCATGG + Intronic
984265681 4:177495821-177495843 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
985195088 4:187420753-187420775 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
985509948 5:307862-307884 CTTGTCCACAGGGCCGGGGGTGG + Intronic
985956122 5:3267467-3267489 CTTTCCCAGAGGCCCCGCCCAGG - Intergenic
987059928 5:14232919-14232941 TATTCCCACAGGGCCTGCCCTGG - Intronic
987488801 5:18551823-18551845 CCTCCCCACAGGGCAGGGCTCGG - Intergenic
987532759 5:19142901-19142923 CCTTCCCGCAGGGCAGGGCTTGG - Intergenic
987543855 5:19287974-19287996 CCTTCCCGCAGGGCAGGGCTTGG + Intergenic
987896313 5:23951526-23951548 CCTTCCCTCAGGGCAGGGCTCGG + Intronic
988279529 5:29127753-29127775 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
988497630 5:31758450-31758472 CTGTCCCCCAGGGTAGGGCCTGG - Intronic
989777402 5:45225841-45225863 CCTCCCCACAGGGCAGGGCTGGG + Intergenic
989956872 5:50369668-50369690 CCTTCCCACGGGGCAGGGCTTGG + Intergenic
990629371 5:57651231-57651253 CTTTCCCACAGAGCTGAGCATGG + Intergenic
991330214 5:65485605-65485627 CCTTCCCGCAGGGCAGGGCTGGG - Intergenic
992532555 5:77666223-77666245 CTTTTCCACACGGCCCCGCCTGG + Intergenic
994701675 5:103142165-103142187 CCTTCCCGCAGGGCAGGGCTCGG - Intronic
994769765 5:103966457-103966479 CCTTCCCACAGGGCAGGGCTCGG - Intergenic
995326395 5:110894157-110894179 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
995870034 5:116734778-116734800 TTTTCCCACAAAGCCAGGCCAGG - Intergenic
996107068 5:119517334-119517356 CCTTCCCGCAGGGCAGGGCTCGG + Intronic
996705135 5:126490342-126490364 CTCTCCCGCTGGGCCTGGCCGGG + Intronic
997282651 5:132658491-132658513 CTCTCCCTCATGGCTGGGCCGGG - Intronic
997457154 5:134025980-134026002 CTTTTCCACCGAGCCTGGCCTGG + Intergenic
998146163 5:139729853-139729875 CTTCCCCACAGGACCAGTCCAGG + Intergenic
1000066059 5:157694068-157694090 CCTTCCCGCAGGGCAGGGCTGGG + Intergenic
1000823685 5:166017158-166017180 TTGTACTACAGGGCCGGGCCCGG + Intergenic
1001054980 5:168441858-168441880 CCTTCCCACAAGGCCGCACCCGG + Intronic
1001831597 5:174793801-174793823 CCTTCCCGCAGGCCCGGGGCTGG + Intergenic
1001843585 5:174901748-174901770 CCTCCCCACAGGGCAGGGCTCGG + Intergenic
1002415571 5:179119315-179119337 CTTGGGCATAGGGCCGGGCCCGG - Intronic
1003170825 6:3720895-3720917 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1003506665 6:6745849-6745871 CTTCCCCACAGGGCAGGGCTCGG - Intergenic
1003508814 6:6762611-6762633 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1004382988 6:15148555-15148577 CTCTCCCACAGGGCCCCGTCAGG + Intergenic
1004397066 6:15254747-15254769 CATAGCCACAGGGCCGGGCGCGG + Intronic
1004861365 6:19807141-19807163 CCTTCCCACGGGGCAGGGCTTGG - Intergenic
1005024669 6:21450915-21450937 CATACAAACAGGGCCGGGCCTGG - Intergenic
1005749901 6:28872723-28872745 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1005759830 6:28958074-28958096 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1006079735 6:31558367-31558389 CCCTCCCCCAGGGCAGGGCCAGG - Exonic
1006520233 6:34567091-34567113 CTGCCCCACAGGGCCTGGGCTGG + Intergenic
1006604066 6:35243820-35243842 ATTTCCCAAAGGGCAGGCCCAGG + Intronic
1007808597 6:44470158-44470180 CTGTCCCAGAGGGCCTGGCTGGG - Intergenic
1008254093 6:49275672-49275694 CCTCCCCACAGGGCAGGGCTTGG + Intergenic
1011143716 6:84189598-84189620 CCTTCCCACAGGGCAGGGCTCGG + Intronic
1011620078 6:89234619-89234641 CCTTCCCACAGGGCAGGGCTTGG - Intergenic
1011870063 6:91882024-91882046 CCTTCCCAGGGGGCAGGGCCCGG - Intergenic
1012189318 6:96261075-96261097 CCTTCCCTCAGGGCAGGGCTCGG - Intergenic
1012520354 6:100113749-100113771 CTTCCCCCCGGGGCCGGGCTCGG - Intergenic
1013048056 6:106507452-106507474 CTTTCCCACAGGCCTGGGCAGGG - Intergenic
1014934948 6:127376118-127376140 CACACACACAGGGCCGGGCCTGG - Intergenic
1015572226 6:134633674-134633696 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1016092806 6:139999714-139999736 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1017992620 6:159504572-159504594 CTTTCACACCGTGCTGGGCCGGG + Intergenic
1018966991 6:168497121-168497143 CTTAACCACAGGGCCAGGGCTGG - Intronic
1019257018 7:59103-59125 CTTTCCCACATGGCCTTGCCTGG - Intergenic
1019447022 7:1076619-1076641 GTTTCCAACAGGGCTGGCCCTGG + Intronic
1019451906 7:1103218-1103240 TTTTACCACAGGGTCGGGCGTGG - Intronic
1019566832 7:1687083-1687105 CATTCCCACAGGGCAGGGCAGGG - Intergenic
1019923818 7:4179664-4179686 CTTTCCCTCAGGGATGGACCTGG + Intronic
1021324150 7:19245714-19245736 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1021660970 7:22917583-22917605 CTTTCCCACAGGGCCTGAAAAGG + Intergenic
1022105191 7:27192054-27192076 CTTTCCAACAGGGCTGGGGATGG + Intergenic
1023814053 7:43935781-43935803 CTCTCCCACAGTGCCAGGACTGG + Intronic
1024030504 7:45456211-45456233 CTTTCACAGAGGGGCTGGCCAGG + Intergenic
1024471997 7:49774684-49774706 CCTTGCCAGAGGGCCGGGTCGGG - Intronic
1026187065 7:68090544-68090566 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1026479244 7:70764202-70764224 CTTCCCCAAGGAGCCGGGCCCGG + Intronic
1027561695 7:79739531-79739553 CTTTCCCGCGGGGCAGGGCTCGG + Intergenic
1028989523 7:97034569-97034591 CCTCCCCACAGGGCAGGGCTCGG + Intergenic
1029267148 7:99351512-99351534 CATACCCACAGGACTGGGCCAGG - Intronic
1029832350 7:103275055-103275077 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1030230921 7:107207631-107207653 CTTACCCACAGGCACGAGCCAGG + Intronic
1032332935 7:130996913-130996935 ATTTCTCACAGGGCCGAGCTGGG - Intergenic
1033043178 7:137937077-137937099 GTTTCCCAGAGGGCAGGGCTGGG - Intronic
1034155040 7:148949311-148949333 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1034331627 7:150288121-150288143 CTACCCCACAGAGCAGGGCCAGG + Intronic
1034967099 7:155398322-155398344 CCTTCCCGCAGGGCAGGGCTTGG - Intergenic
1035006814 7:155669747-155669769 ACTTCCCACAAGGCCGGGGCAGG - Intronic
1035371029 7:158379091-158379113 CATGCACACAGGGCCAGGCCTGG - Intronic
1037425584 8:18751173-18751195 CCTTCCCACAGGGCAGGGCTCGG - Intronic
1037828521 8:22174581-22174603 CCTTCCCAAAGGGCAGGGGCAGG + Intronic
1037877758 8:22556733-22556755 CTTGCTCCCAGGGCCTGGCCAGG - Exonic
1039061329 8:33574133-33574155 CCTTCCCACAGGGCAGGGCTCGG + Intergenic
1039284885 8:36029056-36029078 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1040952908 8:52954042-52954064 CCTTCCCACAGGGTTGGGCTCGG + Intergenic
1041117504 8:54554442-54554464 CTTTCCCATAGGGCCGGGCCAGG - Intergenic
1041604332 8:59762129-59762151 CCTCCCCACAGGGCAGGGCTTGG - Intergenic
1043027145 8:75084284-75084306 CTATCCCACTGGGAAGGGCCTGG - Intergenic
1043110125 8:76169800-76169822 CCTTCCCGCAGGGCAGGGCTCGG + Intergenic
1043398909 8:79864776-79864798 TTTTCCCACAGGTCTGGGCTTGG - Intergenic
1043709906 8:83403172-83403194 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1044633453 8:94300464-94300486 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1045131920 8:99163530-99163552 CCTTCCCACGGGGCAGGGCTCGG - Intronic
1048659913 8:136587369-136587391 ATGGCCCACAGGGCCGGGCACGG - Intergenic
1048757476 8:137755251-137755273 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1049371169 8:142268105-142268127 CTTGCCCTCAGGGCCAGGCATGG + Intronic
1049496251 8:142935144-142935166 CTTTCTCACAGGGCAGAACCTGG + Intergenic
1049861613 8:144902430-144902452 CTTCCCCACAGGGCGGGGCTGGG + Intergenic
1050920635 9:11197095-11197117 CGTTCCCGCAGGGCAGGGCTCGG + Intergenic
1052391714 9:27886510-27886532 CTGTCCCACCTGGCCGGGCGCGG - Intergenic
1052985325 9:34482895-34482917 CCTTCCCACGGGGCAGGGCTCGG - Intronic
1053073528 9:35114980-35115002 CCTTGCCCCAGGGCCTGGCCTGG - Intronic
1053344264 9:37366432-37366454 CTTTCTCACAGGGCCCAGCATGG + Intergenic
1053547891 9:39042488-39042510 CCTTCCCACGGGGCAGGGCTGGG - Intergenic
1053812014 9:41862529-41862551 CCTTCCCACAGGGCAGGGCTTGG - Intergenic
1054109089 9:61087294-61087316 TTATCCAACAGGGCCGGGCGCGG - Intergenic
1054611768 9:67243831-67243853 TTATCCAACAGGGCCGGGCGCGG + Intergenic
1054618581 9:67324910-67324932 CCTTCCCACAGGGCAGGGCTTGG + Intergenic
1056639954 9:88361811-88361833 CTCTTCAACAGGGCCGGGCACGG + Intergenic
1056771372 9:89480549-89480571 CCTTCCCACGGGGCAGGGCTCGG - Intronic
1057190473 9:93084327-93084349 CTTGCCAACAGGGCCCGGCAGGG + Intronic
1057628610 9:96701019-96701041 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1057907169 9:98992236-98992258 CCTTCCCGCAGGGCAGGGCTTGG - Intronic
1059139491 9:111839054-111839076 CTATCTCACAGGGCAGGGCTAGG - Intergenic
1059991542 9:119870413-119870435 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1060091366 9:120746574-120746596 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1060514307 9:124256529-124256551 CTGGCCCACAGGAGCGGGCCTGG - Intergenic
1061714468 9:132510124-132510146 CACTCCCCCAGGGCCTGGCCAGG + Intronic
1061774080 9:132948960-132948982 CCTTCCCACCTGGCCTGGCCTGG + Intronic
1061836972 9:133336016-133336038 GTAACGCACAGGGCCGGGCCGGG - Intronic
1062040257 9:134401297-134401319 CTTTCCCAGGTGGACGGGCCTGG + Intronic
1062388828 9:136326120-136326142 CTTTGCCACAGCCCTGGGCCTGG - Intergenic
1062600271 9:137316162-137316184 CTTTCCCACGCGGCCCGGCCCGG - Intronic
1203429816 Un_GL000195v1:80551-80573 CCATCCCACAGGGCAGGGCTTGG + Intergenic
1186152572 X:6690638-6690660 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1187304630 X:18084032-18084054 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1187606062 X:20884513-20884535 TGTGCCCACAGGGCCTGGCCTGG + Intergenic
1189209847 X:39275803-39275825 CCTTCCCATAGGGCAGGGCTCGG + Intergenic
1190045850 X:47111135-47111157 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1190292726 X:49003338-49003360 ATTTCCAGCAGGGCCGGGCGCGG + Intergenic
1190758633 X:53422254-53422276 CTGTACCACTGGGCCGGGGCGGG + Intronic
1194650802 X:96512383-96512405 CCTTCCCACGGGGCAGGGCTCGG - Intergenic
1196319512 X:114270692-114270714 CCTTCCCGCAGGGCAGGGCTCGG - Intergenic
1197707613 X:129646039-129646061 CTTCCCCACGGGGCTGGGCTTGG + Exonic
1199175558 X:144783847-144783869 CCTTCCCACGGGGCAGGGCTCGG + Intergenic
1200002040 X:153067160-153067182 CCTGCCCACAGGGCAGGGCTGGG + Intergenic
1200005692 X:153082865-153082887 CCTGCCCACAGGGCAGGGCTGGG - Intergenic
1200102225 X:153693894-153693916 CTTTCCCACAGGGCCGGGCCTGG + Exonic
1200217542 X:154374696-154374718 CTTTCTCGCCGGGCCGGGCCGGG - Intergenic
1200550330 Y:4571076-4571098 CCTTCCCGCAGGGCAGGGCTTGG + Intergenic
1201496915 Y:14598328-14598350 CCTTCCCACGGGGCAGGGCTCGG - Intronic