ID: 1200104902

View in Genome Browser
Species Human (GRCh38)
Location X:153706688-153706710
Sequence AGACTCAGCTTGTCCAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 3, 2: 2, 3: 16, 4: 126}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200104897_1200104902 1 Left 1200104897 X:153706664-153706686 CCTGGATGTCCCCAGAGACATTC 0: 4
1: 0
2: 1
3: 20
4: 140
Right 1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG 0: 1
1: 3
2: 2
3: 16
4: 126
1200104892_1200104902 26 Left 1200104892 X:153706639-153706661 CCTAACCTCCTGCTAAACATTGG 0: 4
1: 0
2: 0
3: 7
4: 113
Right 1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG 0: 1
1: 3
2: 2
3: 16
4: 126
1200104900_1200104902 -10 Left 1200104900 X:153706675-153706697 CCAGAGACATTCTAGACTCAGCT 0: 4
1: 0
2: 0
3: 13
4: 194
Right 1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG 0: 1
1: 3
2: 2
3: 16
4: 126
1200104894_1200104902 21 Left 1200104894 X:153706644-153706666 CCTCCTGCTAAACATTGGCTCCT 0: 4
1: 0
2: 1
3: 5
4: 118
Right 1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG 0: 1
1: 3
2: 2
3: 16
4: 126
1200104899_1200104902 -9 Left 1200104899 X:153706674-153706696 CCCAGAGACATTCTAGACTCAGC 0: 4
1: 0
2: 0
3: 11
4: 156
Right 1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG 0: 1
1: 3
2: 2
3: 16
4: 126
1200104898_1200104902 -8 Left 1200104898 X:153706673-153706695 CCCCAGAGACATTCTAGACTCAG 0: 4
1: 0
2: 0
3: 13
4: 204
Right 1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG 0: 1
1: 3
2: 2
3: 16
4: 126
1200104896_1200104902 18 Left 1200104896 X:153706647-153706669 CCTGCTAAACATTGGCTCCTGGA 0: 4
1: 0
2: 0
3: 11
4: 116
Right 1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG 0: 1
1: 3
2: 2
3: 16
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200104902 Original CRISPR AGACTCAGCTTGTCCAAAAC GGG Intronic
900168643 1:1255380-1255402 AGACGCACCTCGTCCAGAACGGG - Exonic
901009162 1:6189130-6189152 AGACTCACCATCTCCAAAAAAGG + Intronic
901118865 1:6873883-6873905 AGACTTTGCTAGTCCAAAGCAGG - Intronic
902185113 1:14719136-14719158 AGACTCAGCTTCTGCAAGGCAGG + Intronic
905675968 1:39825303-39825325 AGACTCACCATGTCCAAGACAGG - Intergenic
906129844 1:43449555-43449577 AGACTCAGCTTGCCCCAAGCTGG - Intronic
908765637 1:67552566-67552588 AGACTCAGTTTGTTAAATACTGG + Intergenic
910226699 1:84943289-84943311 AAACTCAGTTTGCCCAAGACAGG - Intronic
911588157 1:99714827-99714849 AGACTTAACATGTCCAAAATGGG - Intronic
914992084 1:152507507-152507529 AGACACTGCCTGTCCAACACAGG + Intergenic
915421638 1:155787346-155787368 AGACACAGTTGCTCCAAAACGGG + Intronic
916233858 1:162566087-162566109 AAACTCACGTTGTCCAAAGCTGG + Exonic
919279315 1:195466700-195466722 AGAGTCAGCTTGGTCAAAAGTGG - Intergenic
921751839 1:218803644-218803666 AGAATCAAATTGTCCAAATCAGG - Intergenic
1069857723 10:71450963-71450985 ATCCTCAGTTTGTCCAAAGCTGG + Intronic
1071588835 10:86851968-86851990 TGCCTCAGCTTGTCCAGTACAGG - Intronic
1074851443 10:117442653-117442675 AGTCACAGCTTTTCCAAGACTGG - Intergenic
1075135574 10:119782565-119782587 AGCCTCAGCCTGTCAAAGACAGG - Intronic
1077409567 11:2397182-2397204 AGACTCAGCTTGGCCAACTTGGG + Exonic
1077820744 11:5737515-5737537 AACCTCAGCTTCTCCTAAACTGG + Intronic
1078759974 11:14243965-14243987 AAACTCATCATGTCCAAAATGGG + Intronic
1082665714 11:55972955-55972977 ACATTCAGCTTGTCCCAACCTGG - Intergenic
1084856305 11:71989867-71989889 AGAAACAGCTTGTCAAACACAGG - Intronic
1085727323 11:78965346-78965368 AGACAGAACTTTTCCAAAACTGG - Intronic
1086945880 11:92843638-92843660 AGACTCAACATGCCCACAACAGG - Intronic
1093442908 12:19220445-19220467 TGACATAGCTTGTCCACAACCGG - Intronic
1093975815 12:25420873-25420895 AGACTCCGCTTGATTAAAACAGG + Intronic
1094561653 12:31560194-31560216 AAACTCAGAATGTCCAAAAATGG + Intronic
1095796459 12:46224586-46224608 AGACTCACATTGGCCAACACAGG - Intronic
1097527487 12:60755664-60755686 AGACTCATATTTTCTAAAACCGG + Intergenic
1097922380 12:65090170-65090192 AGACTAAGCTGGTCCAGAGCTGG + Intronic
1098611054 12:72458649-72458671 AAACTCAGTATGTCCAAAGCAGG + Intronic
1099455103 12:82853641-82853663 AGAATCATCTTTTCCAAACCTGG - Intronic
1100509448 12:95255114-95255136 AGATTCAACTTGTCTAAAATAGG + Intronic
1102877801 12:116461293-116461315 AGGCTCAGCTTGGCCAACTCAGG - Intergenic
1104719971 12:131039766-131039788 AGACTCAGCTGGGCCCAAACAGG + Intronic
1106190183 13:27445646-27445668 AGACTCAGCATCTCCAACAGTGG + Intronic
1106674168 13:31940111-31940133 AAACTCAGCATGTATAAAACTGG - Intergenic
1106739584 13:32625515-32625537 AGACTCAAATAGTCCAAAAGAGG - Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1112304671 13:98262854-98262876 ATACTTAGCTTCTCCAAAACAGG - Intronic
1114356712 14:21917580-21917602 AGGCTCTGCTTCTCCAAGACTGG - Intergenic
1116530385 14:45965652-45965674 AGAATTAGCTTGCCAAAAACTGG + Intergenic
1117870090 14:60191352-60191374 AGCCTCAGCTTGTCCAACTCTGG - Intergenic
1117874987 14:60243059-60243081 AGACCAAGCTTGTCCAACCCTGG + Intergenic
1117987102 14:61397314-61397336 AAACTCCACTTGTCCAAAGCTGG - Intronic
1124030580 15:26007230-26007252 AGAATCAGCTTGTCAAGATCAGG + Intergenic
1125888330 15:43246305-43246327 ACAGTCAGTTTGTCCAAATCAGG - Intronic
1125893768 15:43285330-43285352 AGACTCAGCCTGGCCAACATGGG + Intronic
1126487294 15:49195686-49195708 TGCCTAAGCTGGTCCAAAACTGG + Intronic
1128419671 15:67479634-67479656 AGACTCAGCATAACCCAAACAGG - Intronic
1128771449 15:70285628-70285650 AGTCCCAGAGTGTCCAAAACAGG - Intergenic
1129605618 15:77023642-77023664 AAATTCAGCGTGTCCAAAACCGG - Intronic
1136775037 16:32867372-32867394 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1136895581 16:33994140-33994162 AGACTCAGCTTGTCCAAAATGGG + Intergenic
1139510698 16:67426962-67426984 AGCCTCAGCATGTCTAAAGCTGG - Intergenic
1139545454 16:67647730-67647752 AGACTCAGCCTGGCCCAGACAGG + Exonic
1140545231 16:75801473-75801495 ATAATCAGATTGTCCAAAAGAGG + Intergenic
1203077455 16_KI270728v1_random:1129481-1129503 AGACTCAGCTTGTCCAAAATGGG - Intergenic
1154194577 18:12255954-12255976 AGCAACAGCTTGTCCATAACAGG - Intronic
1159712929 18:71785414-71785436 AGACACAGCTTTTTAAAAACAGG + Intronic
1161440471 19:4288653-4288675 GGACTCCCCTTGTCCAAAAATGG + Intronic
1161450320 19:4342308-4342330 AGACTCAGCATAGCCCAAACCGG - Intronic
1162273604 19:9636067-9636089 AGACTCAGCCCGTCCACACCCGG - Intronic
1162297592 19:9824063-9824085 GGTGTCAGCTTGACCAAAACAGG + Intronic
1164680169 19:30129242-30129264 AGACTCGGCTTGAGCAAGACAGG + Intergenic
1167187927 19:47960645-47960667 AGACTCAGAATAGCCAAAACAGG + Intergenic
926390788 2:12390462-12390484 AAACTCAGAATTTCCAAAACTGG - Intergenic
930657747 2:54023068-54023090 AGACCCAGCCTGACCAAAAAGGG + Intronic
932422190 2:71607823-71607845 ACACTGAACTTGTCCAAAACTGG - Intronic
932604825 2:73157954-73157976 ACACTCAGCTTGTCCCACGCAGG - Intergenic
932932397 2:76057714-76057736 AGGCTGACCTTGTCCAAACCTGG + Intergenic
935016539 2:99187873-99187895 AAACTCAGCTTGGCCATCACAGG - Intronic
935751848 2:106242231-106242253 ACACTCAGCTTTTCCCCAACAGG + Intergenic
935912263 2:107909780-107909802 ACACTCAGCTTTTCCCCAACAGG + Intergenic
940825519 2:158407453-158407475 ATACATAGCTTCTCCAAAACTGG + Intronic
947274617 2:228376258-228376280 AGAGTCGACTTCTCCAAAACTGG - Intergenic
1170646735 20:18203193-18203215 AGACCCAGCTTGTCCAGCAATGG - Intergenic
1172027638 20:31959983-31960005 AAACTGCTCTTGTCCAAAACAGG - Intergenic
1172441423 20:34969112-34969134 AGACACATCTTGTCCACCACTGG + Intergenic
1173642957 20:44616298-44616320 AGACTGAGCTTCTCCAGCACAGG + Intronic
1173720918 20:45257305-45257327 AGATTGAGCTTTTCTAAAACAGG + Intergenic
1176425351 21:6545311-6545333 AGACCCAGCGTGTCTGAAACCGG - Intergenic
1177893693 21:26836943-26836965 AGACTGAGATGGTCCAAAAAAGG + Exonic
1178703128 21:34851023-34851045 TGACTGAGCCTCTCCAAAACGGG - Intronic
1179644970 21:42770227-42770249 ACCCCCAGCATGTCCAAAACAGG + Intronic
1179700842 21:43153628-43153650 AGACCCAGCGTGTCTGAAACCGG - Intergenic
1180925594 22:19551976-19551998 AGAATCAGCTTGTCCATTTCTGG + Intergenic
1184138177 22:42561764-42561786 AGACCCAACTGGTCCCAAACTGG - Intronic
1185152620 22:49173587-49173609 AGAATCAACTTGTCAAAGACCGG + Intergenic
951713462 3:25611050-25611072 AAACTCAGCATGTCTGAAACTGG - Intronic
952001966 3:28796416-28796438 AAATTCACCTTGTCCAAAACTGG - Intergenic
954536088 3:51360517-51360539 GGACTTAGCTTATCCAAACCTGG - Exonic
955151160 3:56368726-56368748 ATGCCCAGCTTGTCAAAAACAGG + Intronic
957931522 3:86884564-86884586 AAACTTAGCATGTCCAAATCTGG - Intergenic
959436010 3:106316344-106316366 AGAGTCAGCTGGTTCAAAATAGG + Intergenic
962179283 3:133188698-133188720 TTACTCAGCCTGTCTAAAACAGG - Intronic
964509340 3:157433775-157433797 AGAAGCAGTTTGTACAAAACGGG + Intronic
964798370 3:160524918-160524940 TGAAGCAGCTTGTCCAACACTGG + Intronic
965218366 3:165894227-165894249 AAACTCAGTATGTCCAAAATCGG + Intergenic
965781136 3:172287288-172287310 AAACTCAGCATGTCCAAGAATGG - Intronic
969187449 4:5487054-5487076 AGAAACAGCTTGACCAAAAAGGG - Intronic
973981598 4:56312847-56312869 AAACTCTGATTCTCCAAAACAGG + Intronic
976658850 4:87518238-87518260 AGACACAGCTTGCCCACAGCTGG + Intronic
977123819 4:93139031-93139053 AGACTCAGGTTGTATAAATCAGG + Intronic
977482041 4:97591535-97591557 AGAATCAGGTTATCCAAAAAGGG - Intronic
978119511 4:105061538-105061560 TGACTCAGCTTATACAAAAGGGG - Intergenic
979264643 4:118687001-118687023 AGACTTAGCTTGAGTAAAACTGG + Intronic
985168935 4:187127689-187127711 AGACTCAGATTGTGCCAGACAGG - Intergenic
987541163 5:19258002-19258024 AGAGACAGCTTGTACAAAAGAGG + Intergenic
989533079 5:42530706-42530728 TGACACAGCTTGTGCAAAACTGG - Intronic
990729228 5:58790134-58790156 AAACTCAGCATGTCCAAAATAGG + Intronic
994942885 5:106347510-106347532 TTACTCAGCATGTCTAAAACTGG + Intergenic
997409255 5:133678598-133678620 AAAATGAGCATGTCCAAAACTGG - Intergenic
998225177 5:140321436-140321458 AGACTTAGAGTGGCCAAAACTGG + Intergenic
1002056626 5:176601572-176601594 AAACTCAGCTTGTCCAAAAACGG - Intronic
1002569292 5:180130892-180130914 CGACTCTCCTTGTCCAAAGCTGG + Intronic
1004403593 6:15311237-15311259 AGACTCACCATGCCCAAGACTGG - Intronic
1005112774 6:22302422-22302444 AGACTCAGTTTCTCTAAAAATGG + Intergenic
1011354487 6:86459971-86459993 AGAGTTAGCTTGCCAAAAACAGG + Intergenic
1011980298 6:93366828-93366850 AGAATCAACTTGTGCAAAAAAGG + Intronic
1012622635 6:101365014-101365036 AGCCTCATCTTATCCATAACAGG - Intergenic
1013781512 6:113733654-113733676 AGAGTCAGCATGTCCAGAACAGG + Intergenic
1014044458 6:116869128-116869150 AAGCTCAGCTTGGCCAAACCTGG - Intergenic
1014880455 6:126717573-126717595 ATAATTAGCTTGTCCAAAAATGG - Intergenic
1014944971 6:127486676-127486698 AGCCTCAGCTTGTCCAAAAGAGG + Intronic
1015290816 6:131536566-131536588 ATACTTGGCTTGTCCAAAACTGG + Intergenic
1018470652 6:164094906-164094928 AGACTCAGAGTGTCATAAACTGG + Intergenic
1020360049 7:7318604-7318626 AGACACAGCCTGACCAACACAGG + Intergenic
1021839462 7:24710681-24710703 AGAATCAGTTTGTTCAAATCAGG - Intronic
1028772858 7:94647165-94647187 AAACTAAGCTTGTCCAAACTAGG + Intronic
1030333162 7:108294810-108294832 AAACTAAGCATGTCCAAAAAAGG - Intronic
1038035040 8:23680457-23680479 AATCTCCGCTTGTCCAAGACAGG - Exonic
1038438714 8:27557005-27557027 AGACTCAGCAAGTCCAGAACAGG + Intergenic
1052479288 9:29002092-29002114 AGACTCAGATTGTCTCAGACAGG - Intergenic
1052865886 9:33464405-33464427 AGACTCAGCTTGTGCAGGCCCGG - Intronic
1059976621 9:119724694-119724716 AAACTCAGCATGTCCCAAAGTGG + Intergenic
1060175475 9:121494410-121494432 TGGCTCAGCTTGTCCAAATGTGG - Intergenic
1062370523 9:136236465-136236487 AGCCTCAGATTGGCCAAAACTGG - Intronic
1186570193 X:10706872-10706894 ATAGTCAACTTATCCAAAACAGG + Intronic
1188028983 X:25243050-25243072 AGACTCAGCTTCTCCAGGGCCGG + Intergenic
1189280028 X:39814522-39814544 AGACACAGCATGACCAAAATGGG + Intergenic
1190156311 X:47995675-47995697 AGGCTCAGCAAGTCCAAAACAGG + Intronic
1195513307 X:105742829-105742851 AAATTTAGCTTGTCCCAAACAGG + Intronic
1196821593 X:119705587-119705609 AAACTCAACATGTCCCAAACTGG - Intergenic
1198019356 X:132643227-132643249 AACCTCATCTTGTGCAAAACGGG + Intronic
1200104902 X:153706688-153706710 AGACTCAGCTTGTCCAAAACGGG + Intronic
1201511199 Y:14765484-14765506 AGAACCACCTTGTGCAAAACAGG + Intronic