ID: 1200105308

View in Genome Browser
Species Human (GRCh38)
Location X:153708808-153708830
Sequence TGGACTTGGGGCAGCCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200105308_1200105314 -4 Left 1200105308 X:153708808-153708830 CCCAAAGGGCTGCCCCAAGTCCA No data
Right 1200105314 X:153708827-153708849 TCCATTTTGGTACAGCTGCGTGG No data
1200105308_1200105319 30 Left 1200105308 X:153708808-153708830 CCCAAAGGGCTGCCCCAAGTCCA No data
Right 1200105319 X:153708861-153708883 GCCTCCCAGCACACAGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200105308 Original CRISPR TGGACTTGGGGCAGCCCTTT GGG (reversed) Intronic