ID: 1200105314

View in Genome Browser
Species Human (GRCh38)
Location X:153708827-153708849
Sequence TCCATTTTGGTACAGCTGCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200105309_1200105314 -5 Left 1200105309 X:153708809-153708831 CCAAAGGGCTGCCCCAAGTCCAT No data
Right 1200105314 X:153708827-153708849 TCCATTTTGGTACAGCTGCGTGG No data
1200105302_1200105314 21 Left 1200105302 X:153708783-153708805 CCTAGAGCAGACCCGAGAAGGCT No data
Right 1200105314 X:153708827-153708849 TCCATTTTGGTACAGCTGCGTGG No data
1200105304_1200105314 10 Left 1200105304 X:153708794-153708816 CCCGAGAAGGCTGCCCCAAAGGG No data
Right 1200105314 X:153708827-153708849 TCCATTTTGGTACAGCTGCGTGG No data
1200105306_1200105314 9 Left 1200105306 X:153708795-153708817 CCGAGAAGGCTGCCCCAAAGGGC No data
Right 1200105314 X:153708827-153708849 TCCATTTTGGTACAGCTGCGTGG No data
1200105308_1200105314 -4 Left 1200105308 X:153708808-153708830 CCCAAAGGGCTGCCCCAAGTCCA No data
Right 1200105314 X:153708827-153708849 TCCATTTTGGTACAGCTGCGTGG No data
1200105307_1200105314 -3 Left 1200105307 X:153708807-153708829 CCCCAAAGGGCTGCCCCAAGTCC No data
Right 1200105314 X:153708827-153708849 TCCATTTTGGTACAGCTGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200105314 Original CRISPR TCCATTTTGGTACAGCTGCG TGG Intronic