ID: 1200105319

View in Genome Browser
Species Human (GRCh38)
Location X:153708861-153708883
Sequence GCCTCCCAGCACACAGACGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200105313_1200105319 16 Left 1200105313 X:153708822-153708844 CCAAGTCCATTTTGGTACAGCTG No data
Right 1200105319 X:153708861-153708883 GCCTCCCAGCACACAGACGCTGG No data
1200105315_1200105319 10 Left 1200105315 X:153708828-153708850 CCATTTTGGTACAGCTGCGTGGC No data
Right 1200105319 X:153708861-153708883 GCCTCCCAGCACACAGACGCTGG No data
1200105308_1200105319 30 Left 1200105308 X:153708808-153708830 CCCAAAGGGCTGCCCCAAGTCCA No data
Right 1200105319 X:153708861-153708883 GCCTCCCAGCACACAGACGCTGG No data
1200105312_1200105319 17 Left 1200105312 X:153708821-153708843 CCCAAGTCCATTTTGGTACAGCT No data
Right 1200105319 X:153708861-153708883 GCCTCCCAGCACACAGACGCTGG No data
1200105309_1200105319 29 Left 1200105309 X:153708809-153708831 CCAAAGGGCTGCCCCAAGTCCAT No data
Right 1200105319 X:153708861-153708883 GCCTCCCAGCACACAGACGCTGG No data
1200105311_1200105319 18 Left 1200105311 X:153708820-153708842 CCCCAAGTCCATTTTGGTACAGC No data
Right 1200105319 X:153708861-153708883 GCCTCCCAGCACACAGACGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200105319 Original CRISPR GCCTCCCAGCACACAGACGC TGG Intronic