ID: 1200105957

View in Genome Browser
Species Human (GRCh38)
Location X:153712575-153712597
Sequence TTTAAAAAGCATGTGGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 892
Summary {0: 1, 1: 4, 2: 13, 3: 123, 4: 751}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200105950_1200105957 12 Left 1200105950 X:153712540-153712562 CCCCGTGGTTAACTTTTTTTAAA 0: 1
1: 3
2: 0
3: 24
4: 302
Right 1200105957 X:153712575-153712597 TTTAAAAAGCATGTGGAGGCTGG 0: 1
1: 4
2: 13
3: 123
4: 751
1200105951_1200105957 11 Left 1200105951 X:153712541-153712563 CCCGTGGTTAACTTTTTTTAAAC 0: 1
1: 3
2: 2
3: 24
4: 353
Right 1200105957 X:153712575-153712597 TTTAAAAAGCATGTGGAGGCTGG 0: 1
1: 4
2: 13
3: 123
4: 751
1200105952_1200105957 10 Left 1200105952 X:153712542-153712564 CCGTGGTTAACTTTTTTTAAACA 0: 4
1: 0
2: 4
3: 70
4: 593
Right 1200105957 X:153712575-153712597 TTTAAAAAGCATGTGGAGGCTGG 0: 1
1: 4
2: 13
3: 123
4: 751

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200105957 Original CRISPR TTTAAAAAGCATGTGGAGGC TGG Intronic
900278887 1:1852524-1852546 TTTAAAAAATATTTTGAGGCCGG - Intronic
900281456 1:1872272-1872294 TTTTAAAAGATTGTTGAGGCTGG - Intronic
900675562 1:3883316-3883338 TTTAAAAAGTAAGAGGAGCCAGG + Intronic
900925545 1:5703938-5703960 TAGAAAATGCACGTGGAGGCTGG + Intergenic
901150663 1:7099038-7099060 TTTAAAAAGCATGGGGGTGGCGG - Intronic
901318205 1:8323194-8323216 TTTAAAAAGTAAGTTGAGGCTGG + Intronic
901579868 1:10233317-10233339 TTAAAAAAACATTTGAAGGCCGG + Intronic
904151636 1:28446482-28446504 ATTTAAAAGTGTGTGGAGGCTGG + Intronic
904471899 1:30741332-30741354 TTTAAACGGCAGGTGGAAGCAGG - Intronic
904635312 1:31875906-31875928 TTTAAAAAGCATGTTGTAGCTGG - Intergenic
904654060 1:32029359-32029381 TTTAAAAAGTACCTGGTGGCTGG + Intronic
904702882 1:32368570-32368592 TGTGAAAAGCAGGAGGAGGCAGG + Intronic
904948055 1:34213835-34213857 TTTTAAAAGGATGTGGATGCTGG - Intronic
905425546 1:37880892-37880914 TTTAAAAATCTTTTAGAGGCAGG + Intronic
906559274 1:46743565-46743587 ATTTAAAAGCATGCTGAGGCCGG + Intergenic
907054976 1:51358017-51358039 TATAAAAAGCATTTTGAGCCAGG + Intronic
907257564 1:53191349-53191371 TTTAAATAACATGTCCAGGCCGG + Intergenic
907356060 1:53874810-53874832 TTTAAAAAGCATGTTGTGGAAGG - Intronic
907419576 1:54337789-54337811 TTCAAAAAGTTTGAGGAGGCCGG - Intronic
907459187 1:54595048-54595070 TATAAAAAGCATATATAGGCCGG + Intronic
907496732 1:54850370-54850392 TTTACAAAGCATGTGAATTCTGG - Exonic
907956719 1:59235508-59235530 TTTAAAAAGCAACCAGAGGCAGG + Intergenic
908519103 1:64923833-64923855 TTTAAAAAGCAGCAGGAGTCGGG - Intronic
909040943 1:70650686-70650708 TTTAAAAGGCATGGGATGGCAGG + Intergenic
910299185 1:85686255-85686277 TTTAAAAAGAATGTTAAGGGTGG - Intronic
911052561 1:93682847-93682869 TTTAAAATCCATCTGGAGGCCGG - Intronic
911297703 1:96137733-96137755 TTTAAAATGCAAGTAGAGGCAGG + Intergenic
911419997 1:97628932-97628954 TTTATTTAGCATGTAGAGGCTGG - Intronic
911741733 1:101394067-101394089 TTTAAGAAGCACGTGGGGGATGG - Intergenic
912934942 1:113994879-113994901 ATTAAAAAGAATGAAGAGGCCGG + Intergenic
913108816 1:115640242-115640264 TTTAAATGCCATGTAGAGGCCGG - Intergenic
913175112 1:116266364-116266386 TTTAAGAAGCAGGTGGAGTGTGG - Intergenic
914711870 1:150221798-150221820 TTTAAAAATTATTTTGAGGCTGG + Intronic
914732271 1:150382114-150382136 TTTAAAAAGCTTATGCAGACAGG - Intronic
914960780 1:152204536-152204558 TTCAAAAAGAATGAGGAGTCAGG + Intergenic
915019463 1:152765384-152765406 TTTAAAATGCATTTGGCAGCAGG + Intronic
915140053 1:153762150-153762172 ATTAAAGAGCACTTGGAGGCTGG + Intronic
915368618 1:155329700-155329722 TTATAAAAGCATTTGGCGGCCGG + Intronic
915870012 1:159549225-159549247 TTTAAAATTCATATGGAGGCTGG + Intergenic
915976730 1:160396074-160396096 TTGGAAAAGCATGTGGAGTGGGG + Intergenic
916206521 1:162320558-162320580 TTTAAAAAGTAATTGGAGCCGGG + Intronic
916510815 1:165470972-165470994 ACTAAAAAGCATCTGGGGGCCGG + Intergenic
916672986 1:167041135-167041157 TTTTAAAGTCATGTGAAGGCTGG + Intergenic
916729061 1:167550282-167550304 TTTAAAATGCATATAGAGGCGGG - Intronic
916793820 1:168147189-168147211 ATAAAAAAACATGTAGAGGCCGG + Intergenic
916833503 1:168517721-168517743 TTTAAAAAATATGTGAAGGTAGG + Intergenic
917063992 1:171072106-171072128 TTTAAAAAGCATGTTATGACCGG + Intergenic
917707800 1:177652095-177652117 TTTAAAAGAAATGTGGAGGATGG - Intergenic
917774879 1:178322253-178322275 TTTAAAAAGTACGGTGAGGCAGG - Intronic
917777661 1:178354913-178354935 TTTAAAAATCTTGTGAAGCCTGG + Intronic
917952999 1:180060889-180060911 TTTAAAAAGAATGTGCTGGAAGG + Intronic
917988591 1:180348411-180348433 GTTAGAAGGCATGTTGAGGCAGG + Intronic
918212725 1:182365907-182365929 ATTAGAAAGCTTGAGGAGGCTGG + Intergenic
918304537 1:183234181-183234203 TTTAAAAAGTATGTATAGGCCGG - Intronic
918396858 1:184122401-184122423 TTTAAAAAACATTTTTAGGCCGG + Intergenic
918514183 1:185344328-185344350 TTTAAAACACATGATGAGGCTGG - Intergenic
920391568 1:205606551-205606573 GTTAAAAAGCCTGTTTAGGCTGG - Intronic
921082001 1:211748386-211748408 CTTCAAAAGCAACTGGAGGCCGG + Exonic
921400208 1:214713699-214713721 TAAAAAAAGAAAGTGGAGGCTGG - Intergenic
921699635 1:218253477-218253499 TTTAAAAAATATTTGGGGGCCGG - Intergenic
921757294 1:218873535-218873557 AGTAAAGAGCATGTGCAGGCAGG + Intergenic
921760730 1:218911169-218911191 TTTTAAAAGAATGTGGATGTTGG + Intergenic
921775931 1:219100175-219100197 TTTAAAGAGGATGAAGAGGCTGG + Intergenic
921873357 1:220166491-220166513 TTTAAAAAGGAGGTGGAAGGAGG + Intronic
922327200 1:224538963-224538985 TTTAAACAGTAAGTAGAGGCTGG - Intronic
922510286 1:226160388-226160410 GTTAAGAAGCATGTGGTTGCTGG - Intronic
923274276 1:232383332-232383354 ATTAAAATGCTTCTGGAGGCCGG - Intergenic
923352710 1:233125314-233125336 TTTAAGAAGCAGGTAGAGGAAGG - Intronic
923438149 1:233988580-233988602 TGGAAAGAGCATGTGGAGGGTGG - Intronic
923751370 1:236749498-236749520 TTAAAAAAGAATGCTGAGGCTGG + Intronic
924151543 1:241135128-241135150 TTAAAACAGCATGTTGCGGCCGG + Intronic
924375340 1:243402129-243402151 TTTAAAAAGTAAAAGGAGGCTGG + Intronic
924831247 1:247597372-247597394 TTTAAAACGTATATGTAGGCCGG - Intergenic
1063135968 10:3216651-3216673 TTTAAAAATAATGTATAGGCCGG + Intergenic
1063456182 10:6184347-6184369 TTTAAAAAGCTTCTCCAGGCTGG - Intronic
1063847582 10:10148200-10148222 TATAAAAATCACATGGAGGCTGG + Intergenic
1064309761 10:14201832-14201854 TTTAAAATTCACGTGGAGGCTGG + Intronic
1064470815 10:15633714-15633736 TTTAAAAGGAATTTGGTGGCTGG - Intronic
1064723733 10:18256642-18256664 TTTAAAATCCATGTTTAGGCCGG + Intronic
1064734060 10:18362642-18362664 TAGAAAATGCATGTAGAGGCTGG + Intronic
1065112900 10:22457365-22457387 TAAATAAAGCATGTGGAGGGAGG + Intergenic
1065218244 10:23471438-23471460 TATAAGAAGCCAGTGGAGGCTGG - Intergenic
1065298502 10:24299750-24299772 TTTATGAAGCCTGTGGATGCTGG + Intronic
1065615137 10:27513329-27513351 TTTAAAACTCATGTGTGGGCTGG - Intronic
1065811654 10:29448850-29448872 ATTAAAAAGCGTGTGCATGCAGG + Intergenic
1065821286 10:29528023-29528045 TTTAAAAAGTAGATTGAGGCCGG - Intronic
1065849990 10:29779762-29779784 CTTAAAAAGCTTATGCAGGCCGG + Intergenic
1066481859 10:35804115-35804137 TTAAAAAATCATGTAAAGGCCGG + Intergenic
1066541497 10:36451516-36451538 TTTAAAATGAAAGTGCAGGCCGG - Intergenic
1066675421 10:37882120-37882142 TGTAAAAATCAAGTGGAGGCCGG - Intergenic
1068217236 10:53998753-53998775 TTTAAAAATAACGTGTAGGCTGG + Intronic
1068488163 10:57685898-57685920 TTTAAATAACATGTAGAAGCAGG + Intergenic
1069262831 10:66420502-66420524 ATTAAAAACAATATGGAGGCCGG + Intronic
1069443692 10:68453195-68453217 TTTAAAAAAATTGTGGTGGCTGG - Intronic
1069564755 10:69456381-69456403 TTTAAAAAGGAAGTTTAGGCTGG - Intronic
1070191960 10:74119175-74119197 TTTAGAAAGGATGTGGAGGAAGG - Exonic
1070861078 10:79662733-79662755 TATAACAAGCATGTGGAGGCAGG - Intergenic
1070876179 10:79812857-79812879 TATAAAAAGCATGTGGAGGCAGG + Intergenic
1070957830 10:80475879-80475901 TATAAAAAGGATGGGGAGGCCGG - Intronic
1071643109 10:87335005-87335027 TATAACAAGCATGTGGAGGCAGG + Intergenic
1071957940 10:90779446-90779468 AACAAAAAGCAGGTGGAGGCAGG - Intronic
1072234293 10:93439768-93439790 TATAAAAAGCATATGAAGACAGG + Intronic
1072325873 10:94298179-94298201 TTTAAAATGAGTGTGGTGGCTGG - Intronic
1072350676 10:94553842-94553864 TTTAAAAAACAATTGAAGGCCGG - Intronic
1072785574 10:98277765-98277787 TCTAAAATGTATATGGAGGCTGG - Intergenic
1072945016 10:99801960-99801982 TTTAAAAATCAACTGGAGGAAGG - Intronic
1073200910 10:101734695-101734717 TTTAAAAAGCATGGGGGGCCGGG + Intergenic
1073515600 10:104072987-104073009 TCTAACAAGCACGTAGAGGCAGG - Intronic
1073725717 10:106228089-106228111 TTAAAAAAGCCTGTGGAGATCGG - Intergenic
1074450922 10:113559149-113559171 TTTAAAAGGCAAGCGAAGGCTGG - Intronic
1074635226 10:115307556-115307578 AATAAAAAACCTGTGGAGGCCGG - Intronic
1074916955 10:117966444-117966466 TTACAAAAGAATTTGGAGGCAGG + Intergenic
1075073619 10:119335657-119335679 TTTAAAGAACATGCGCAGGCTGG - Intronic
1075366292 10:121892980-121893002 CTTAAAAAGCAATTGTAGGCCGG + Intronic
1076386463 10:130060526-130060548 ATTAAAAAGTATGTGCAGCCGGG + Intergenic
1076562410 10:131375822-131375844 TTTAAAAACCTTCTGGTGGCAGG + Intergenic
1077232497 11:1464318-1464340 TTGAAAAAGGATGTGGTGGCCGG + Intergenic
1078197722 11:9150222-9150244 TGTAAAAAGGAAGTGGAGGGTGG + Intronic
1078284617 11:9939390-9939412 TTTTAAATGCATGTTTAGGCCGG - Intronic
1078491432 11:11772807-11772829 TTTAGAAGGCATGTGGCCGCTGG - Intergenic
1078951250 11:16137137-16137159 TCTAAAGAGCATGTGGGGGCCGG + Intronic
1079739782 11:24043640-24043662 CTTAAGAAGTATGTGGAGGAGGG + Intergenic
1080280954 11:30555881-30555903 TTAAAAAAATATGTGGAGACTGG - Intronic
1080446187 11:32339136-32339158 TTGAAAAGGCCTGTTGAGGCAGG + Intergenic
1080560039 11:33454791-33454813 TTAAAAAACCATTTGGTGGCTGG + Intergenic
1080976766 11:37351691-37351713 TTTAAAAATGAGGTGGAGTCTGG - Intergenic
1081461219 11:43274472-43274494 ATTACAAGGCAAGTGGAGGCAGG + Intergenic
1081664212 11:44907022-44907044 TTCAAAAAGCCTGTTGAGGAAGG - Intronic
1081933841 11:46890888-46890910 CTTAAAAAGCATTCTGAGGCTGG - Intronic
1082309489 11:50629776-50629798 ATCACAAAGCAAGTGGAGGCAGG + Intergenic
1082880684 11:58034381-58034403 TTAAAAAAGCAAGTGCTGGCCGG - Intronic
1083260293 11:61518841-61518863 TTGTCACAGCATGTGGAGGCTGG - Intronic
1083605857 11:63978510-63978532 TTTAAAAAGCAAGCAGGGGCCGG - Intronic
1083790140 11:64979408-64979430 TTTAAAAAGCCTATGCTGGCCGG - Intergenic
1084048327 11:66583898-66583920 TTTAAAATGGAGATGGAGGCCGG - Intergenic
1084276748 11:68055746-68055768 TTTATAAAGCAGGCTGAGGCCGG + Intronic
1085068180 11:73517325-73517347 TTTAAAAAGTATGTAGAGGCTGG - Intronic
1085412890 11:76302016-76302038 TTGAAACACCATCTGGAGGCTGG - Intergenic
1085567066 11:77523712-77523734 TTTTAAAAGTATGAAGAGGCCGG - Intronic
1086354806 11:85984534-85984556 TTTTAAAAGCATATGGATACAGG - Intronic
1086637124 11:89102651-89102673 TTTAAAAAGTATGCTGAAGCTGG + Intergenic
1087262823 11:96029936-96029958 TTTAAAATTCATATGGAGCCAGG + Intronic
1087774742 11:102246969-102246991 GTTAAAATGCATATTGAGGCTGG + Intergenic
1087940420 11:104090322-104090344 TTAAAAATGGATGTAGAGGCGGG + Intronic
1087973791 11:104518768-104518790 TTAAAAAAGCATGATGTGGCCGG + Intergenic
1088584903 11:111353663-111353685 TTTAAGATGTATGTGGTGGCCGG - Exonic
1088713284 11:112527182-112527204 ATCAGAAAGCATGTGGAGGGAGG - Intergenic
1089080478 11:115772412-115772434 TTTAAAAAGCTTGTTATGGCCGG + Intergenic
1089362479 11:117900247-117900269 TTCACAAAGCAGGTGGGGGCAGG - Intergenic
1089506766 11:118968601-118968623 TTTGAAAAGCATCTGTTGGCTGG - Intergenic
1089535756 11:119160092-119160114 TTGAACAAGAATGTGGAGGCAGG + Intronic
1090195223 11:124810104-124810126 TTTCTAAAGCATGTGATGGCTGG + Intergenic
1091146961 11:133288468-133288490 TTTAGAAAAAAAGTGGAGGCAGG + Intronic
1091318273 11:134631561-134631583 TTTAAAACAGCTGTGGAGGCTGG + Intergenic
1091329276 11:134718049-134718071 TTCAAAAAGCAGGAGAAGGCAGG + Intergenic
1091717720 12:2791640-2791662 TTTAAGAAGTATGTAGAGGCCGG + Intergenic
1092008459 12:5088744-5088766 TTTGGAAAGCATGACGAGGCCGG - Intergenic
1092182686 12:6456947-6456969 TTTAAAAAGTACGTGGTGGCTGG - Intronic
1092461102 12:8686776-8686798 TTTTAAAAGTCAGTGGAGGCCGG - Intronic
1092514728 12:9198175-9198197 TTTAAAAAGCTTGTAGAGATTGG - Intronic
1092798405 12:12137864-12137886 CTTTAAAAGCATGAAGAGGCTGG + Intronic
1093028387 12:14265600-14265622 TTTAAAACGTATCTGGTGGCTGG - Intergenic
1093658067 12:21720630-21720652 TGCAAAAAGCAAATGGAGGCTGG + Intronic
1094022000 12:25924729-25924751 TTTAAACAGGATGTGTAGTCAGG - Intergenic
1094437850 12:30441204-30441226 TTTAAAATGCATTTTGAGGCTGG - Intergenic
1094545262 12:31398823-31398845 TTTAAAAAGTTTTTTGAGGCTGG + Intronic
1094568406 12:31620594-31620616 GGTAAAAAGGATGTGGAGTCTGG - Intergenic
1094611550 12:31999970-31999992 TTTTAAAAGTTTCTGGAGGCTGG + Intergenic
1095220182 12:39602448-39602470 TTAAAAAACCATTTGCAGGCTGG - Intronic
1095459340 12:42425681-42425703 TTTTAAAAACCTGAGGAGGCTGG - Intronic
1095558720 12:43539724-43539746 TTTAAAAAGCATGCTGAAGAGGG + Intronic
1095856711 12:46867618-46867640 TTTGAATAGAATGAGGAGGCAGG + Intergenic
1095897817 12:47297872-47297894 TTTAAAAAGACTGTTGAGGCTGG - Intergenic
1096027980 12:48384500-48384522 TTTAAAAGGTATGTGCAGGCTGG - Intergenic
1096275145 12:50200495-50200517 TTTAAAATCTATTTGGAGGCTGG - Intronic
1096446748 12:51699868-51699890 TTAAAAAAGTAGTTGGAGGCCGG + Intronic
1096862044 12:54536361-54536383 TTCAAAAAGCACTTGAAGGCTGG + Intronic
1097007372 12:55928857-55928879 TTTAAAAAGTATTTCCAGGCCGG + Intronic
1097804449 12:63950224-63950246 CTAAAAAGGTATGTGGAGGCTGG - Intronic
1097998254 12:65913970-65913992 TTTAAAAAGCATGTTGCAGGGGG - Intronic
1098225806 12:68322334-68322356 TTTAAAATACATGTGATGGCCGG + Intronic
1099184672 12:79504223-79504245 TTTAAAAAGCAGTTTGGGGCCGG - Intergenic
1099205395 12:79720993-79721015 CTTAAAAAGGAGGTAGAGGCCGG - Intergenic
1100527428 12:95432763-95432785 TTTAAAAAGAAATTGGGGGCTGG + Intergenic
1101191933 12:102343163-102343185 GTTAAAAAGTACCTGGAGGCTGG - Intergenic
1101869059 12:108547114-108547136 TTTAAAAAGCGTTTTAAGGCTGG - Intronic
1101907047 12:108834789-108834811 TTTAAAAAGCATGTGCATCCTGG - Intronic
1102239876 12:111318384-111318406 TGAAAAAAGCAGGTGAAGGCTGG - Intronic
1102740894 12:115206742-115206764 TTGAAAAAACATATAGAGGCCGG - Intergenic
1102746805 12:115256115-115256137 TTTCGAAAGCATGTGAAAGCAGG + Intergenic
1102849951 12:116232789-116232811 TTTAAAAAGCATTTGTTGCCAGG + Intronic
1103091308 12:118100071-118100093 TTTAAAAAGCAGGTGAGGGCCGG + Intronic
1103104027 12:118206889-118206911 TTTAAAAACAATGAGGAGGCCGG - Intronic
1103667563 12:122582118-122582140 TGTGAAAACCATCTGGAGGCCGG + Intronic
1103823380 12:123716492-123716514 TTTAGAAAGTTTATGGAGGCCGG + Intronic
1103998904 12:124847697-124847719 TTTAGAAAGCAGGTGGAGGAAGG + Intronic
1105327075 13:19380428-19380450 ATTAAAAAACAAGTGGTGGCTGG - Intergenic
1105345391 13:19566590-19566612 TTTAAAAATAATTTTGAGGCTGG + Intergenic
1105358615 13:19685141-19685163 TTTACAAATGATGTGGAGGCAGG - Intronic
1105501984 13:20980800-20980822 TTTAAACAACATGTGATGGCAGG + Intronic
1105864572 13:24447908-24447930 ATTAAAAAACAAGTGGTGGCTGG + Intronic
1106469137 13:30039190-30039212 TTTAAAAAGCCTCTGGGGGCAGG - Intergenic
1106826341 13:33525316-33525338 TTAAAAACACATTTGGAGGCAGG - Intergenic
1106843788 13:33714846-33714868 TATAAAAAGCATGAGGTGGTTGG + Intergenic
1106918272 13:34538422-34538444 GTTAAAATGCATGTTGAAGCTGG - Intergenic
1106936840 13:34731669-34731691 TATAAAAAGACTGTGGTGGCAGG - Intergenic
1107434012 13:40365740-40365762 TTTAAAAAGCATCTCAGGGCTGG - Intergenic
1107574348 13:41701342-41701364 TTAAAAAAACATGTGCAGGAAGG + Intronic
1108346489 13:49551602-49551624 TTAAAAAAGCATTAGAAGGCCGG + Intronic
1109619525 13:64884104-64884126 TTTAAAAAGTATGTGTATGAAGG - Intergenic
1109825277 13:67710975-67710997 TTGAAAAAGCCTGTGGAGCAAGG + Intergenic
1113031551 13:105998992-105999014 TTTTAAAAACCTGTGGAGGATGG + Intergenic
1113850356 13:113414245-113414267 TGTCAGAAACATGTGGAGGCTGG - Intergenic
1114150441 14:20032311-20032333 TTGAAAATGCATTTTGAGGCTGG + Intergenic
1114223032 14:20714066-20714088 TATAAAAAGCATGTGTTGGCAGG - Intergenic
1114320138 14:21540498-21540520 TTTAAAAAGCAACAGGAGCCGGG - Intergenic
1114812857 14:25920784-25920806 TTTGAAAAGGATGGAGAGGCAGG + Intergenic
1114922450 14:27350119-27350141 TTTAAAAAGTATGTGGATTTAGG - Intergenic
1115579832 14:34746826-34746848 TTTAAAACCTATGTGGAGACAGG - Intergenic
1115842127 14:37483805-37483827 TTTAAAAATTTTGTAGAGGCAGG + Intronic
1116017747 14:39427640-39427662 TTTAAAATGCATTTTTAGGCAGG + Intronic
1116456259 14:45123912-45123934 TTTTAAAAGAATGAGGGGGCTGG - Intronic
1116484851 14:45435544-45435566 GTTAAAAAGCAGTTGCAGGCTGG + Intergenic
1116795248 14:49383316-49383338 TTTAAGAAGAAGGTGGAGCCTGG + Intergenic
1117363097 14:54997614-54997636 ATTAAAAAAAATGGGGAGGCCGG + Intronic
1118092796 14:62500741-62500763 TTCTAAAAGAATGTGGAGGCAGG - Intergenic
1118121086 14:62843704-62843726 TTTAAAAGCCATGTAGGGGCCGG - Intronic
1118602244 14:67479110-67479132 TTAAAAATGCTTATGGAGGCTGG + Intronic
1118687956 14:68310547-68310569 TTTAAAAAGCAGGTCACGGCTGG + Intronic
1118764622 14:68901541-68901563 TTTAAAATGCATGATGAGGCCGG - Intronic
1118914570 14:70092076-70092098 TTTGAAAATCATGTGGAGTTAGG - Intronic
1119885069 14:78133527-78133549 ATCAAATAGCATGTAGAGGCTGG - Intergenic
1120104507 14:80479231-80479253 TGTAAAAAGGAGGTGGAGGGTGG + Intronic
1120168507 14:81225529-81225551 TTTAAAATGCATTGTGAGGCTGG - Intergenic
1120344319 14:83265843-83265865 TTTAAAAAGCAGATTGAGGCTGG + Intergenic
1120946750 14:90005030-90005052 TTTATAAAGTGTGTGAAGGCTGG - Intronic
1121110073 14:91306739-91306761 TTACAAAAGCAGGTGGGGGCTGG + Intronic
1121188716 14:92002875-92002897 TTGAAAAAGAATGTGCTGGCTGG - Intronic
1121302106 14:92880271-92880293 TTTAAAATGGGTGTGGTGGCGGG - Intergenic
1121667075 14:95680696-95680718 TGTAAAAAGCCTGTGGAGAGAGG - Intergenic
1122142379 14:99670406-99670428 TTGAAAAAGAGTGTGGAGTCTGG - Intronic
1122169283 14:99858479-99858501 TGTAAAAGGAATGAGGAGGCTGG - Intronic
1122401037 14:101467567-101467589 TTTAGAGAGCATGGGGAGGAGGG - Intergenic
1122470523 14:101963094-101963116 TTTAAGGAGCATGTGGAAGAGGG - Intergenic
1122471978 14:101974826-101974848 TTTCAAAAGCTTACGGAGGCCGG - Intronic
1122488003 14:102094644-102094666 ATTAAAAAGAAAATGGAGGCTGG + Intronic
1123415451 15:20091647-20091669 TTTAAGAAGCAGGTGTGGGCCGG + Intergenic
1123524790 15:21098761-21098783 TTTAAGAAGCAGGTGTGGGCCGG + Intergenic
1124477486 15:30047348-30047370 TTTAAAAAACATGTTTAGGACGG - Intergenic
1124647622 15:31450096-31450118 CTTAATAATCAAGTGGAGGCGGG - Intergenic
1124949250 15:34301240-34301262 GTTAACAAACATGTTGAGGCCGG - Intronic
1125024128 15:35013406-35013428 ATTACAAAGCACGTGGAGTCAGG + Intergenic
1125431771 15:39602599-39602621 ATTAAACAGGATGTAGAGGCAGG + Intronic
1126444518 15:48727335-48727357 ATTTAAAAGTATGTGAAGGCCGG - Intronic
1127084173 15:55409106-55409128 TTGAAAAAGGATTTGGTGGCCGG + Intronic
1127944183 15:63733554-63733576 ATTAAAAATCATCTGTAGGCTGG + Intronic
1128012527 15:64311340-64311362 TTTAAAATGCGTGTGTAGGCTGG - Intronic
1128135695 15:65261752-65261774 TTTAAAATGCCTGTTAAGGCCGG - Intronic
1128397381 15:67242125-67242147 TTTAAAAATCATATCGGGGCCGG + Intronic
1128638503 15:69318368-69318390 TTTAACACCCAGGTGGAGGCAGG + Intronic
1128811922 15:70579170-70579192 TTTAAAAAGCAGGTGTGGGCTGG - Intergenic
1128844144 15:70874493-70874515 TTTAAAGAGCAGGTGGAAGAAGG + Intronic
1129534318 15:76299576-76299598 TTTAAGAAACATCAGGAGGCAGG - Intronic
1129583391 15:76836574-76836596 TTTAAAAAGTAATTGTAGGCTGG + Intronic
1129649793 15:77476183-77476205 TTTAAAAAACTAGTGGAGGCTGG + Intronic
1129861967 15:78870158-78870180 TTAAAAAAGTATGTGCAGGCTGG + Intronic
1130150971 15:81311356-81311378 TTTAAAGAAAATATGGAGGCAGG - Exonic
1130389687 15:83444661-83444683 TTTAAAAAGCTTTTCTAGGCTGG - Intergenic
1130530298 15:84742249-84742271 TTAAAAAAGCAATTTGAGGCCGG - Intergenic
1130578006 15:85109633-85109655 TTTATACAGAGTGTGGAGGCAGG + Intronic
1130835433 15:87645520-87645542 TTTTAAAAGCATGAGGAGAGGGG + Intergenic
1131837005 15:96400836-96400858 TTTAAAAATCATCTGTGGGCCGG - Intergenic
1132187379 15:99813239-99813261 TTTAAAAAGGAAGGGCAGGCTGG - Intergenic
1132428293 15:101739497-101739519 TTTAAAAAGGAAGGGCAGGCTGG + Intronic
1133072887 16:3258173-3258195 TTTATAAAGCTAGTGGTGGCTGG - Intergenic
1133148644 16:3809470-3809492 TTTAAAAAGGTGGTTGAGGCCGG - Intronic
1133376674 16:5293022-5293044 TTCAAATAGAATTTGGAGGCTGG + Intergenic
1133460466 16:5982570-5982592 TTAAAAAATCATGTGCAGGCTGG - Intergenic
1133488100 16:6239791-6239813 TTTAACAGTCAGGTGGAGGCTGG - Intronic
1133974948 16:10594063-10594085 TTTTAAAAGAATTTGGAGGCCGG - Intergenic
1134130501 16:11646403-11646425 TTAAAATAGCATTTTGAGGCTGG + Intergenic
1134321675 16:13169904-13169926 TTTAAAATACATGTTCAGGCCGG + Intronic
1134423833 16:14119420-14119442 TTTAAAATACATAAGGAGGCAGG + Intronic
1134640956 16:15828885-15828907 TTTAAAAAGAAGGAAGAGGCCGG + Intronic
1135222692 16:20626449-20626471 TTTAAAAATCATGTAGGGGTAGG + Intronic
1135341361 16:21650925-21650947 TTAAAAAACCATATTGAGGCTGG + Intronic
1135647475 16:24175673-24175695 ATTAAAAGGCATGAGGGGGCTGG + Intronic
1135923058 16:26668450-26668472 TTTAAAATGCATTTTGAGGCTGG + Intergenic
1135948825 16:26892789-26892811 TTACAAAAGCATGTGGTGGTGGG - Intergenic
1136023907 16:27457664-27457686 TTCAAAACGTTTGTGGAGGCCGG + Intergenic
1136774003 16:32861498-32861520 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1136896606 16:34000021-34000043 TTTGAAAAGCATGTGGAGGCTGG + Intergenic
1137309920 16:47245048-47245070 TTTAAAAAACATTTTTAGGCCGG + Intronic
1137658288 16:50180397-50180419 TTCAAAAAATATGTGAAGGCTGG - Intronic
1137733207 16:50704812-50704834 TTTAAAATGGTTTTGGAGGCTGG - Intronic
1137992068 16:53168357-53168379 TTTAAAAATATTGTGCAGGCTGG - Intronic
1138148948 16:54637476-54637498 TTAGAAAACCATGTGGATGCGGG - Intergenic
1138160813 16:54752028-54752050 TCAAAAAAGCATTTGGGGGCGGG - Intergenic
1138624960 16:58244148-58244170 TTTAAAACGCAGTTTGAGGCTGG + Intronic
1138669568 16:58602389-58602411 TTAAAAAACCATCTGTAGGCCGG + Intronic
1138812861 16:60171294-60171316 TTTAAAAACCATGATGAGGCCGG + Intergenic
1138977678 16:62227446-62227468 TTTAAAAAGGACATGGAGACGGG - Intergenic
1139280593 16:65767002-65767024 TTGAAAAAGGATTTGCAGGCTGG - Intergenic
1139402514 16:66694411-66694433 TTTAAAAGGCAATTGCAGGCAGG + Intronic
1139809814 16:69605141-69605163 TTAAAAAAGAAAGTGGAGGCCGG + Intronic
1139938717 16:70589917-70589939 TTTAAAAATCATGGTAAGGCCGG - Intronic
1140111807 16:72011340-72011362 TGTGAAAACCATGTAGAGGCTGG + Intronic
1140494328 16:75370406-75370428 TTTAAAAATAATGTGGAGGGAGG + Intronic
1140509580 16:75497179-75497201 TTTAAAAATCATGAACAGGCCGG - Intergenic
1141338062 16:83176144-83176166 TTTAAAAAGTAGGTTGAGGCCGG - Intronic
1141565357 16:84897911-84897933 TTTAAAAAGCGTGTTTAAGCCGG - Intronic
1141844623 16:86598974-86598996 TCTCAAAAGCAGGTGGAGGCAGG - Intergenic
1141996707 16:87640687-87640709 TTTAAAAAGCGTTTGTTGGCTGG - Intronic
1203076425 16_KI270728v1_random:1123609-1123631 TTTGAAAAGCATGTGGAGGCTGG - Intergenic
1142550919 17:738861-738883 GTTAAAAAGAATGTTGGGGCCGG - Intronic
1142575143 17:901994-902016 TTTAAACAGCAAGCTGAGGCCGG - Intronic
1142695836 17:1632953-1632975 GTAAAAAAGCAAGTTGAGGCTGG + Intergenic
1142837258 17:2595854-2595876 TTAAAAAAGGATGTGGGGGGAGG - Intronic
1142943020 17:3398858-3398880 TTTAAAACTCAGGTGTAGGCTGG + Intergenic
1142964935 17:3574650-3574672 TCAAAAAATGATGTGGAGGCCGG + Intronic
1143000368 17:3790856-3790878 TTAAAAAGACATTTGGAGGCCGG + Intronic
1143241988 17:5451399-5451421 TTTAAAAAGAAAATTGAGGCTGG - Intronic
1144146633 17:12405227-12405249 TTTAAGAAGCAAGTTGAGGCTGG - Intergenic
1144486052 17:15665214-15665236 TTTAAAGAGGCTGTAGAGGCCGG + Intronic
1144565560 17:16356238-16356260 TTAAAAAGGCATGTGCTGGCTGG + Intergenic
1144615355 17:16766443-16766465 TATAAAAAGCAGATGTAGGCCGG + Intronic
1144897346 17:18549219-18549241 TATAAAAAGCAGATGTAGGCCGG - Intergenic
1145135026 17:20396502-20396524 TATAAAAAGCAGATGTAGGCCGG + Intergenic
1145229851 17:21165633-21165655 TTTAAGAAGCATATTAAGGCCGG + Intronic
1146309696 17:31757750-31757772 TTTAAAATGCTTATGAAGGCAGG - Intergenic
1146368877 17:32251674-32251696 TTTAAAAAGCTGGTGGGGGGTGG - Intronic
1146894407 17:36531096-36531118 ATTAAAAAAAATTTGGAGGCTGG + Intronic
1147039378 17:37706253-37706275 TTTAAAAATTATTTTGAGGCTGG - Intronic
1147310811 17:39595312-39595334 TCAAAGAAGCATGTGGAGACTGG + Intergenic
1147733916 17:42622098-42622120 TTCAAAAAACAAGTGGAGGCTGG + Intergenic
1148044723 17:44736278-44736300 ATTAAAAAGTAAATGGAGGCCGG - Intronic
1148925411 17:51080584-51080606 TTTAAAAAGCATCTTAAGGCTGG + Intronic
1149086764 17:52727154-52727176 TATAAAAAGCATGAATAGGCTGG - Intergenic
1149299829 17:55294836-55294858 TTTAAAAAGCATTTGTATGTAGG + Intronic
1149546930 17:57510722-57510744 TTTTAAAACCAAGAGGAGGCCGG - Intronic
1149802702 17:59585424-59585446 TTTAAGAAGCATTTTGAGGCTGG + Intronic
1149843789 17:59990067-59990089 TTTAAGAAGCATTTTGAGGCTGG - Intergenic
1150295699 17:64006219-64006241 TTTAAAAAGCTTCAGCAGGCTGG + Intronic
1150421841 17:65043824-65043846 TTTAAAAATCCTTTCGAGGCTGG + Intronic
1150454385 17:65294999-65295021 TTAAAGAAGCAAGAGGAGGCTGG + Intergenic
1150463182 17:65370175-65370197 TTAAAAAAGTATGTAGTGGCCGG - Intergenic
1150739317 17:67766659-67766681 TTTAAAAAGCTGGTGATGGCCGG - Intergenic
1151033540 17:70771152-70771174 TTTTAAAAATATCTGGAGGCCGG - Intergenic
1151325692 17:73378714-73378736 TTTAAAAATCATTTCTAGGCTGG - Intronic
1151780979 17:76245252-76245274 TGTAAAAAGAATGTGCGGGCTGG + Intergenic
1151870960 17:76836474-76836496 TTTAAAAAGCATGTCTTGGCCGG + Intergenic
1152031248 17:77844902-77844924 TTGGAGAAGCATGGGGAGGCAGG - Intergenic
1152168425 17:78726336-78726358 TTTTAAAAGATTGTTGAGGCCGG - Intronic
1152176405 17:78790681-78790703 TTTAAAATGAATGTGTTGGCCGG - Intronic
1152707298 17:81851224-81851246 TTTAAGAAGTTTGAGGAGGCCGG - Intronic
1153231808 18:2944644-2944666 CTTAAAAGGTTTGTGGAGGCCGG - Intronic
1153308008 18:3650557-3650579 TATAAAAATGACGTGGAGGCTGG - Intronic
1153509240 18:5834094-5834116 TATACAAAGCAGGTGGAGGGTGG + Intergenic
1153616586 18:6940612-6940634 GTTAAAGAGCGGGTGGAGGCAGG + Intergenic
1155642932 18:28041694-28041716 TATAAAAACAATGTTGAGGCAGG - Intronic
1156005420 18:32435189-32435211 TTTAAAAAGCCAAAGGAGGCAGG + Intronic
1157092242 18:44650038-44650060 TATTAAAAGCTTGTTGAGGCCGG - Intergenic
1157154514 18:45252847-45252869 ATTAAAAAGCATGATTAGGCTGG + Intronic
1158212732 18:55068834-55068856 TTTCAAAAGCCAGTGGGGGCTGG - Intergenic
1158965973 18:62622571-62622593 TTTAAAAAAGGTTTGGAGGCCGG + Intergenic
1159304652 18:66625448-66625470 TATAAAAAGCACATGTAGGCTGG + Intergenic
1159606672 18:70481416-70481438 TTTAAAATTCATGTGGAGGTTGG - Intergenic
1160207513 18:76847087-76847109 TTGAAAAATGATGTCGAGGCCGG - Intronic
1160500391 18:79398770-79398792 TTTAAAAACAATGTACAGGCCGG + Intronic
1161528959 19:4775419-4775441 TTAAAAAAGAAAGAGGAGGCTGG + Intergenic
1161612138 19:5249013-5249035 TATAAAAAGGAAATGGAGGCAGG + Intronic
1162376357 19:10307810-10307832 ATTCAAAAGCCTGGGGAGGCCGG - Intronic
1162493377 19:11008675-11008697 GTTAAAAAGCAAGTGAGGGCTGG + Intronic
1162653995 19:12115185-12115207 TTTAAGAAGCCTATAGAGGCAGG - Intronic
1162844847 19:13384399-13384421 GTTCAAAAGCATTTTGAGGCTGG + Intronic
1162892682 19:13745364-13745386 ATAATAAAGCATGGGGAGGCCGG + Intronic
1163234804 19:16023974-16023996 TCTAAGAAGCTTCTGGAGGCCGG + Intergenic
1163286260 19:16350123-16350145 TTTAAAAATCAGATGGAGGCTGG + Intergenic
1163480433 19:17552512-17552534 TTTAGAAAGGATTTGGAGGCTGG - Intronic
1163868524 19:19796697-19796719 TTTAAAAAGCCCCTAGAGGCCGG - Intronic
1164423164 19:28115545-28115567 TATAAAAAGGATGAGGAGGAAGG - Intergenic
1164886539 19:31783248-31783270 TTTAAAATTTTTGTGGAGGCCGG - Intergenic
1165005854 19:32806026-32806048 TCTAAAATGTACGTGGAGGCCGG - Intronic
1165086656 19:33353205-33353227 TTTAAAAATCTTTTGGAGGTCGG - Intergenic
1165135220 19:33663573-33663595 TTTAAAAAGCAGGAGGGGCCAGG + Intronic
1165222886 19:34331695-34331717 TTTCAAAAACATATGGTGGCAGG + Intronic
1165612451 19:37167459-37167481 ATTAAAAAGCATTTGGGGCCAGG - Intronic
1165640761 19:37384021-37384043 TTTAAAAAGCACTTTCAGGCTGG + Intronic
1165870136 19:38965936-38965958 AATAAAAAGAATGTTGAGGCTGG - Intronic
1165949674 19:39467084-39467106 TTTAAAAAGATTGATGAGGCTGG + Intronic
1166091922 19:40514806-40514828 TTTAAACATCAGGTAGAGGCTGG + Intronic
1166911225 19:46159559-46159581 TTTTGAAAGCATGTACAGGCAGG - Intronic
1167065817 19:47185119-47185141 TTTAAAAAGCATATAATGGCCGG - Intronic
1167488114 19:49775220-49775242 TTTAAAAAATATATGGAGACAGG - Intronic
1167946514 19:52992999-52993021 TTTAAAAAGCACGGGGTGGAGGG + Intergenic
1168662569 19:58179356-58179378 TTAAAAAAGCATATGGGGCCAGG + Intergenic
925032540 2:661834-661856 TTTAAAAAGCATTCGTGGGCCGG + Intergenic
925206317 2:2010041-2010063 TTTAAAATGCAATGGGAGGCTGG - Intronic
925304815 2:2840594-2840616 AGTAAAAAGCATGTGGAAGGGGG + Intergenic
925397062 2:3541854-3541876 TTTAAAAAGCAAGGTGGGGCCGG + Intronic
925484893 2:4317141-4317163 CTTAAAAAGAGTGTGAAGGCAGG - Intergenic
926167461 2:10530495-10530517 TTTAAAATGCCAGTTGAGGCTGG - Intergenic
926242057 2:11096174-11096196 TTTAAAATGCAAGTTGAGGCTGG - Intergenic
926526413 2:13986815-13986837 TCTATAAAGCAAGTGGAGGAAGG - Intergenic
926870588 2:17411268-17411290 TTTGAAAAGCATGGGGAAGGAGG + Intergenic
927611968 2:24549864-24549886 TTTAAAAAGGAAATAGAGGCTGG - Intronic
927781242 2:25941009-25941031 TTTAAAAAGAATCTAGGGGCTGG + Intronic
927942559 2:27114287-27114309 TTTAAAAGGCATCTGAGGGCCGG - Intronic
928006333 2:27565458-27565480 CTTAAATAGCAGGTGGAGGGAGG + Intronic
928223629 2:29426741-29426763 TTTAAAAAGCAGTTATAGGCCGG + Intronic
928298569 2:30106435-30106457 TTGCAAAAACCTGTGGAGGCGGG + Intergenic
929431262 2:41888978-41889000 TTATAAAAGCATCAGGAGGCCGG + Intergenic
929586659 2:43120401-43120423 TTTAAAATTTATGTTGAGGCCGG - Intergenic
929640669 2:43575830-43575852 TTTAAATTACATGTGTAGGCCGG - Intronic
929653582 2:43706899-43706921 TTTAAAAATCATATGCTGGCTGG + Intronic
929932819 2:46271978-46272000 TAGAAAAACCATGTGGTGGCCGG - Intergenic
929939836 2:46325123-46325145 CTTAAAAAGCATGGTGAGGAAGG + Intronic
929959012 2:46482241-46482263 TTCAAAAAGGGTGTGGGGGCAGG - Intronic
930574630 2:53131332-53131354 TTTAGAGGGCAAGTGGAGGCAGG - Intergenic
930595883 2:53387474-53387496 ATTACAAAGCAAATGGAGGCAGG + Intergenic
930663470 2:54078892-54078914 GTTAAAAAGCTTATTGAGGCCGG - Intronic
931056488 2:58478067-58478089 TTTAAAAAGAAAGTATAGGCAGG + Intergenic
931732825 2:65168053-65168075 TATAAAAATCATCTGTAGGCTGG - Intergenic
931759513 2:65404271-65404293 TTTAAGAATTATGTGTAGGCAGG + Intronic
932181847 2:69653547-69653569 CCTAAGAAGTATGTGGAGGCTGG - Intronic
932260054 2:70319341-70319363 TTTAAATTGGATGTGGGGGCTGG + Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
932542834 2:72674533-72674555 TTTTAAAAGGCTGTGCAGGCCGG + Intronic
932542957 2:72675804-72675826 TTTAAAAAGTTGGTGGGGGCGGG + Intronic
932631608 2:73348451-73348473 TTTAAAAAGTGTATGGAGGCCGG - Intergenic
932752856 2:74382774-74382796 TTTAAAAAATATGTGGAGGCCGG + Intronic
932802690 2:74755874-74755896 TTAAAAATGCTTGTGGGGGCCGG - Intergenic
933502319 2:83129606-83129628 TTTAAAAATAATGTTCAGGCTGG - Intergenic
933683570 2:85124778-85124800 CTTAAAAAGCATATAGAGGCGGG + Intergenic
935043335 2:99455887-99455909 GTGAAAAAGCAGGTGGAGGGGGG - Intronic
935401736 2:102667283-102667305 TCTAAAAAGAGTGTGGGGGCGGG + Intronic
935955056 2:108367633-108367655 TGTAAAAAGCATGCCAAGGCTGG + Intergenic
935988270 2:108695502-108695524 TATAAAAAGCGTGAGAAGGCCGG - Intergenic
936227853 2:110673893-110673915 ATTAAAAAGTATGTAGGGGCTGG - Intronic
936456081 2:112675311-112675333 GTTAAAAAGGATATGGGGGCTGG + Intergenic
936763038 2:115809552-115809574 TTTAAAAAGAATGTGAAAGGAGG - Intronic
937200696 2:120202749-120202771 TTAAAAAAATATGTGTAGGCTGG + Intergenic
937961664 2:127464708-127464730 TTTTAAAAGCATATGGGGCCTGG - Intronic
938033893 2:128019587-128019609 TTTAAAAATTCAGTGGAGGCCGG + Intronic
938078188 2:128353125-128353147 TCTAAAACTCATGTTGAGGCTGG + Intergenic
938149537 2:128870352-128870374 TTTAAAAGGCATGCTGTGGCGGG - Intergenic
938197003 2:129337257-129337279 TTTAACCAGCAGGTGGAGGATGG - Intergenic
938336940 2:130509240-130509262 TTTTAACAGCCTGGGGAGGCCGG + Exonic
938352901 2:130611506-130611528 TTTTAACAGCCTGGGGAGGCCGG - Exonic
938914208 2:135918213-135918235 TTTAAAAATCATTTGGGAGCTGG - Intronic
939062403 2:137438568-137438590 TTACAAAAACAGGTGGAGGCTGG + Intronic
939202188 2:139051312-139051334 TTTAAAATGCATGGGGAGTAAGG + Intergenic
939244015 2:139599552-139599574 ATTAGAAAACATGTGGGGGCAGG + Intergenic
939698872 2:145363866-145363888 TTTAAAAATAATGAGTAGGCCGG + Intergenic
940287903 2:152050522-152050544 TTTAACAAGCAAATGGAGCCAGG + Intronic
940412355 2:153380310-153380332 TTTAAAATATATGAGGAGGCTGG + Intergenic
940880861 2:158945427-158945449 TTTAAAAAGTCAGAGGAGGCTGG - Intergenic
941165674 2:162080504-162080526 TTTAAAATGTATGTGGCAGCCGG - Intergenic
942162824 2:173210053-173210075 TTTGAAAAGAATATTGAGGCCGG + Intronic
942770730 2:179515072-179515094 ATTAAAAAACATATTGAGGCTGG - Intronic
943220748 2:185102517-185102539 TTTAAAAAGCTTTTGGAGGCTGG + Intergenic
943425550 2:187728699-187728721 TTGAAAAGGCATGTGGACTCTGG - Intergenic
943688341 2:190842922-190842944 TTTAAAATGCATGGGGAGGGTGG + Intergenic
943846103 2:192650652-192650674 TTTAAAAATCATTTTCAGGCAGG + Intergenic
945067490 2:205959400-205959422 TTTAAAAAGTATATTCAGGCCGG - Intergenic
945071210 2:205990818-205990840 TTTAAAAAGCCTGTATTGGCTGG - Intergenic
945796510 2:214371234-214371256 TTTAAGAAGCATATGTTGGCCGG + Intronic
945995980 2:216436263-216436285 TTTAAAAAACAATTAGAGGCCGG - Intronic
946928435 2:224648436-224648458 TTTAAAGACCCTGTGTAGGCCGG - Intergenic
947859056 2:233345854-233345876 TTTAAAATGCAAGGAGAGGCCGG + Intronic
948635664 2:239334724-239334746 TTTAAAATTCATATGGAGGCCGG + Intronic
948737613 2:240019520-240019542 TTTAAAAAGAACGTGGAGGCCGG + Intronic
949011207 2:241679670-241679692 TTGAAAATGCATCTGGAGGCTGG + Intronic
1168784974 20:530768-530790 TTTAAAAACAGTGTGAAGGCTGG - Intronic
1168903793 20:1388496-1388518 TATAGACAGCATGTGGAAGCTGG + Intronic
1170156198 20:13271774-13271796 TTTAAAAAAAATATGGAAGCAGG - Intronic
1170953495 20:20957270-20957292 ATTAAAAAGCACCTGGGGGCTGG + Intergenic
1171992101 20:31704394-31704416 TTTAAAAACCAAGTTCAGGCTGG - Intronic
1173504750 20:43577939-43577961 TGTAAAAAGCAAGTGCTGGCTGG - Intronic
1173956132 20:47034412-47034434 TTTAAAAACTGTGTGGGGGCAGG + Intronic
1174027791 20:47593227-47593249 TTTAAAACGTATGTGGTGGCCGG - Intronic
1174238715 20:49115595-49115617 TTTAAAAGACATTTTGAGGCTGG - Intronic
1174655214 20:52166236-52166258 TTAAAATAGCATGGGGGGGCAGG + Intronic
1174665627 20:52255277-52255299 TTTGAAAAACGTGTGAAGGCAGG - Intergenic
1174789882 20:53468131-53468153 GTTAAAAAGCTAGTGGAGGGGGG + Intronic
1174933282 20:54839548-54839570 GTTAATGAGCAAGTGGAGGCCGG + Intergenic
1174976649 20:55343293-55343315 TTTAAAAAGCATGTGTATGAAGG - Intergenic
1175868381 20:62193941-62193963 TTTAAAACAAATGCGGAGGCTGG + Intronic
1176923388 21:14717166-14717188 TTTAAAACTCATGAGGAGGCTGG - Intergenic
1177318460 21:19491654-19491676 TTTAAAATGCATTTTGAGGCAGG - Intergenic
1178313721 21:31552252-31552274 TGTAAAAATAATGTGCAGGCTGG - Intronic
1178530974 21:33375710-33375732 TTTAAAAAATATGTTCAGGCTGG + Intergenic
1178539091 21:33434224-33434246 TTTAAAAAGCATTTGCAGCCGGG + Intronic
1178597466 21:33967767-33967789 TTTAAAAAGCCACTGCAGGCCGG + Intergenic
1178861068 21:36290226-36290248 TTTAAAAAGCAGGTTTGGGCCGG + Intronic
1179290227 21:40012074-40012096 TTTAAAAAACAGCAGGAGGCTGG + Exonic
1179440814 21:41392806-41392828 TTTAAAAAGGAAATTGAGGCCGG + Intronic
1179462607 21:41547848-41547870 TTTAAAAAGCATGTGGGGCCAGG - Intergenic
1179468245 21:41592683-41592705 TTTGAAAAGTATGTACAGGCCGG - Intergenic
1180012037 21:45057851-45057873 TTTATTAAGGATGTTGAGGCTGG - Intergenic
1180249940 21:46578015-46578037 TTTAAGAAGCTTTTGGAGGCTGG + Intergenic
1180646129 22:17340637-17340659 TTTAAAAAATATGTTGAGGCTGG + Intergenic
1180976773 22:19853102-19853124 TTTGGAAAGCATGTGGGGTCAGG - Intronic
1181339653 22:22167597-22167619 TTTAAAAAGAAAGTTAAGGCAGG + Intergenic
1181410414 22:22714323-22714345 TTTACAGAGGATGTGGAGGGTGG - Intergenic
1181423964 22:22820848-22820870 TTTACACAGGATGTGGAGGGTGG - Intronic
1181984548 22:26790590-26790612 ATTAAAGAGGATGTGGAGGCTGG + Intergenic
1182929355 22:34158077-34158099 TTAAAAAACCCTGAGGAGGCCGG + Intergenic
1182970392 22:34568479-34568501 TCTGAAAGGCATGTGGAGGCAGG - Intergenic
1183155379 22:36070829-36070851 TTAAAAAAGAATGTGATGGCTGG + Intergenic
1183610537 22:38900956-38900978 TTTAAAATGCATTTCGAGGCTGG - Intergenic
1183659646 22:39211646-39211668 TTAAAAAAGTCTGTGGCGGCCGG + Intergenic
1184126851 22:42493166-42493188 TTTAAAAATTATTTGTAGGCCGG - Intergenic
1184487914 22:44792304-44792326 CTGAAAAAGCAACTGGAGGCCGG - Intronic
1184701507 22:46176912-46176934 TTTAAAAAGAATCTGTTGGCCGG + Intronic
1185404302 22:50637901-50637923 TTTTAAAAGCATCTTGAGGCCGG - Intergenic
949356116 3:3182280-3182302 TTAAAAAAATATGTAGAGGCTGG - Intergenic
949969288 3:9389621-9389643 TTTAAAAAGAATTTTGAGACAGG - Intergenic
950244050 3:11399049-11399071 TTTAAAAATCAGATGCAGGCTGG + Intronic
950419389 3:12888885-12888907 CATAAAAAGCATTGGGAGGCAGG + Intergenic
950563925 3:13753142-13753164 TTTAAAAATCACTCGGAGGCCGG - Intergenic
950647324 3:14384969-14384991 TTTATAAAGCATGTCTGGGCGGG - Intergenic
951041471 3:17993144-17993166 TCTAAAAAGCATGTGGATCTAGG - Intronic
951091583 3:18579792-18579814 GTTTAAAAACATGTGGAGTCTGG - Intergenic
951213390 3:20000090-20000112 TTTCCAAAGCCTGAGGAGGCTGG - Intronic
951543991 3:23807104-23807126 TTTGAAAAGCGAGTGGAGGGCGG + Intronic
951715474 3:25639600-25639622 TTAAAAACAAATGTGGAGGCTGG - Intronic
951768635 3:26229633-26229655 TTTAAATATAATGTGCAGGCAGG + Intergenic
952145618 3:30528784-30528806 TCTAAAAGGCATGTCCAGGCTGG + Intergenic
952277857 3:31894936-31894958 TCTAAAAAGCAAGTGGAGGAGGG - Intronic
952289271 3:31999655-31999677 TTTAAAAATGATTTTGAGGCCGG - Intronic
952760615 3:36910441-36910463 TTTTAAAATCATGTTGTGGCTGG + Intronic
953619197 3:44518225-44518247 TTTAAAAAGCATTTGCAGCTGGG - Intergenic
953628576 3:44591696-44591718 TTAAAAAATTAAGTGGAGGCTGG + Intronic
953708701 3:45251239-45251261 TTTAAAAAGCAAAAGGAAGCAGG + Intergenic
953903392 3:46856111-46856133 TCTAAAGAGGATGTGCAGGCTGG - Intergenic
954626918 3:52027298-52027320 TTGAAAATGCACGTCGAGGCTGG + Intergenic
955239685 3:57167567-57167589 GTTATAAAGCATGTATAGGCTGG - Intronic
955524409 3:59805883-59805905 TTTAAAGATCATGGGGAAGCTGG + Intronic
956115928 3:65918673-65918695 TTTAAGAATGTTGTGGAGGCCGG - Intronic
957065613 3:75519495-75519517 TTCAAATAGAATTTGGAGGCTGG - Intergenic
957088964 3:75709294-75709316 GTTTAAAAGTGTGTGGAGGCTGG - Intergenic
958025960 3:88049560-88049582 TTTAAAAAGTTTGGAGAGGCAGG + Intergenic
958031326 3:88114574-88114596 TTTAAAAGGCTGGGGGAGGCAGG - Intronic
958425188 3:93971467-93971489 ATTTAAAATCATATGGAGGCTGG + Intronic
958794273 3:98690470-98690492 TTTAAAATGAAAGTTGAGGCCGG - Intergenic
958827645 3:99051123-99051145 TTTGGAAAGCTTATGGAGGCAGG + Intergenic
959448679 3:106471480-106471502 TTCAGAGAGTATGTGGAGGCTGG - Intergenic
959546220 3:107599470-107599492 TTTAAAAAAAAAGTGGGGGCAGG + Intronic
959861383 3:111219257-111219279 TTTAAAAATTAAGAGGAGGCAGG + Intronic
960579686 3:119266455-119266477 TTTAAAAAGCACATTGTGGCTGG + Intergenic
960966531 3:123108886-123108908 AAAAAAAAGCATGTGGGGGCAGG + Intronic
961059638 3:123817555-123817577 TTTAAAAAGCAAGTGGGAACAGG - Intronic
961115169 3:124323217-124323239 ATGAAAAAGGATGGGGAGGCTGG - Intronic
961189370 3:124945074-124945096 TTTAAACAGCCTTTGGAGGAGGG + Intronic
961287716 3:125819926-125819948 TTCAAATAGAATTTGGAGGCTGG + Intergenic
961415547 3:126753961-126753983 TATAAATTCCATGTGGAGGCGGG + Intronic
961539984 3:127592679-127592701 TTAAAACAGCATGTTGCGGCCGG - Intronic
961841934 3:129721562-129721584 TTCACAAAGCATGTGCAGGCCGG + Intronic
962301632 3:134248918-134248940 TGTATAAAGCATGTAGGGGCAGG + Intronic
962567386 3:136675457-136675479 TTTATAAAGCAAGTGCAGTCTGG + Intronic
962617061 3:137136959-137136981 TTTGAAAAGCAAGGGGAAGCTGG + Intergenic
962727388 3:138244572-138244594 TTTAAAAAGCTTTTAGAGGCCGG - Intronic
962795184 3:138843882-138843904 TTTAAAAAGAATAAGGCGGCTGG + Intergenic
963912176 3:150824187-150824209 TTTAAAATGCATTTCAAGGCTGG + Intergenic
964828806 3:160860232-160860254 TTTAAAAATGATTTGGAGGAAGG - Intronic
965360916 3:167736326-167736348 TTAAAGAAGCAAGTGCAGGCAGG + Intronic
965471340 3:169096564-169096586 TTTATAAGTCATTTGGAGGCTGG - Intronic
965545375 3:169910141-169910163 TTTAAAATGCATGTCTAGGCTGG + Intergenic
965606545 3:170503157-170503179 TTTACAAAGCAAGGGGAGGAGGG - Intronic
965616632 3:170600705-170600727 TATAGAAAGAATGTGGATGCAGG + Intronic
966606581 3:181826957-181826979 TTTCAAAAACTTTTGGAGGCCGG - Intergenic
967017296 3:185493835-185493857 ATTAAAAATCACTTGGAGGCCGG - Intronic
967049468 3:185769347-185769369 TTTAAAAAAAATTTGGAGACAGG - Intronic
967581565 3:191162267-191162289 TTTAAAAAGCATGATGTGGCTGG - Intergenic
967843326 3:194024532-194024554 TTAAAAATGCATGCAGAGGCCGG + Intergenic
968611591 4:1559685-1559707 TTTAAAAAGTAAGGGTAGGCTGG - Intergenic
968844678 4:3033879-3033901 TTTAAAACGGATGTGAAGACCGG - Intronic
969532568 4:7737990-7738012 TTCCAAGAGCATGTGGAGGGAGG + Intronic
969602738 4:8186645-8186667 TTTAAAAAGCCCCTTGAGGCTGG + Intronic
969639765 4:8389806-8389828 TTTAAAAAGCCTTAAGAGGCTGG + Intronic
970229310 4:13892222-13892244 TTTGAAGAGTATGTGGAGGAGGG + Intergenic
970290001 4:14561593-14561615 TTTAATAAATATGTAGAGGCTGG - Intergenic
970741358 4:19241731-19241753 TGTAATAAGAATGTAGAGGCTGG + Intergenic
971322887 4:25619714-25619736 TTTAGAAAGCATTTGGGGGCAGG + Intergenic
971837519 4:31787202-31787224 TTTAAAACGTCTTTGGAGGCTGG - Intergenic
971850337 4:31978033-31978055 TTTAAAAGGCACGAGTAGGCCGG + Intergenic
972495600 4:39631360-39631382 TTTAAAAACTATGTTGTGGCCGG + Intronic
972536657 4:40005592-40005614 ATTGAAAAGAATGTGAAGGCTGG - Intergenic
972540544 4:40035402-40035424 TTTAAAAAAGAAGTGGAGGCTGG + Intergenic
973964456 4:56147308-56147330 TTTAAAATGCATTTTGAGACTGG + Intergenic
974846542 4:67357711-67357733 TTTAAAAAGCATGAGGTTGGAGG - Intergenic
975889008 4:79001713-79001735 TTTAAAAGTCATATGGGGGCTGG - Intergenic
976009242 4:80467492-80467514 TTTGAAAAGATTGAGGAGGCGGG - Intronic
976384435 4:84439248-84439270 TTGAAAAAGCACCTGGAGGTTGG - Intergenic
976494625 4:85712999-85713021 TTTAAAATGTATGTCTAGGCTGG + Intronic
976866038 4:89728211-89728233 ATTAAAAGGCATGTCGAGGATGG - Intronic
977455040 4:97248241-97248263 TTATAAAAGCATGTGTAGGCTGG - Intronic
977909290 4:102513870-102513892 TTTAAAAATAATGTGGACTCTGG + Intronic
977927324 4:102716011-102716033 ATTAAAAAGAATGAGGAGGCCGG + Intronic
977933416 4:102773669-102773691 TTAAAAAAGTAAGTAGAGGCTGG - Intergenic
978389116 4:108206075-108206097 TTTAAAAAGAAAGTGGAAGAGGG - Intergenic
978755267 4:112295012-112295034 TTAAAAACGCATGTACAGGCTGG + Intronic
979780787 4:124649360-124649382 TTGTAAAAGAATGTGGAGGCAGG + Intergenic
980319161 4:131245622-131245644 TTTAAAAAGCATGTGGAAGGAGG - Intergenic
980845849 4:138324067-138324089 TTTAAAAAGCATGTGGTAGTTGG + Intergenic
980907449 4:138962265-138962287 TTTAAAAATCATGAGGAGGCCGG + Intergenic
982175359 4:152700963-152700985 ATCAAAAGGCAAGTGGAGGCAGG + Intronic
982213821 4:153063206-153063228 TTTAAAAAAAAGGTGGAGGGGGG + Intergenic
982692237 4:158561922-158561944 TTTAAAATACAGGTTGAGGCCGG - Intronic
982830681 4:160055717-160055739 ATTACAAGGCAAGTGGAGGCAGG + Intergenic
982955162 4:161755607-161755629 TTTATAAAGTATGTGGAGGAAGG + Intronic
983792308 4:171813316-171813338 TTTATATAGCGTCTGGAGGCCGG + Intronic
984124971 4:175796876-175796898 TTTTAAAAGCATGTTTAGACAGG - Intronic
984499655 4:180543504-180543526 TTTAAAAAATATGTGCAAGCAGG - Intergenic
984643359 4:182195354-182195376 TTTAAAAAATATCTTGAGGCTGG + Intronic
985251289 4:188027082-188027104 TTTAAAAAGCAAGTTTAGCCGGG + Intergenic
985268524 4:188172957-188172979 TTTAAAAATTAGCTGGAGGCTGG + Intergenic
986339348 5:6775958-6775980 TTCCAAAAGCAGGTGTAGGCGGG + Intergenic
986512231 5:8519709-8519731 TTTAAAAAGTATTTATAGGCCGG - Intergenic
987733938 5:21813825-21813847 GGTAAAAGGCATGTGGAGGGTGG - Intronic
988258728 5:28854633-28854655 TTTAAAAAATATGTGTAGTCAGG + Intergenic
988961479 5:36375653-36375675 GTTAAAAAGAATTAGGAGGCCGG + Intergenic
989010010 5:36859682-36859704 TTTAAAAACCATGAAGTGGCAGG - Intergenic
989503564 5:42198565-42198587 TTTAAACATCAGATGGAGGCTGG - Intergenic
989789750 5:45383397-45383419 TTTAAATTCCATGAGGAGGCTGG + Intronic
990364565 5:55056754-55056776 TTTAAAATGCATGTGCTGGCTGG - Intergenic
990754552 5:59054389-59054411 TTTTGAAGGCATGTGGATGCTGG + Intronic
991689269 5:69210829-69210851 TCTAAAAAGAATGTTGAGGCCGG - Intergenic
992225100 5:74612587-74612609 TTTTAAAAAAATGTTGAGGCAGG - Intergenic
992236914 5:74719645-74719667 TTTAAAAAGCATTAAGTGGCTGG + Intronic
992562673 5:77967901-77967923 TTTAAAAAGCAAATAGGGGCTGG + Intergenic
994287780 5:97991294-97991316 TTTAAAAAGCTTGAGAAGGAGGG + Intergenic
995161358 5:108987147-108987169 TTTTAAAACCTTGTAGAGGCTGG + Intronic
995480210 5:112585810-112585832 TATAAAACGCAGGTGGAGACTGG + Intergenic
996666915 5:126070777-126070799 TTTAAAAAGCAGTGGTAGGCTGG + Intergenic
997811321 5:136973267-136973289 TTTAAAAAATAGGTTGAGGCTGG - Intergenic
998039065 5:138939713-138939735 TTTAAAAAATATGTTGAGGTCGG - Intergenic
998213011 5:140215842-140215864 TTTAAAAAGTCTGTATAGGCGGG + Intronic
998611516 5:143694313-143694335 TTTAAAAAGGAGGAGGAGGAGGG - Intergenic
998728391 5:145044956-145044978 CTTAAAATGCAGGTGTAGGCTGG + Intergenic
998787141 5:145725037-145725059 TTTAAAAAGTATTTGTTGGCTGG - Intronic
998820272 5:146051786-146051808 TTTAAATAGCATCTCAAGGCTGG - Intronic
999118138 5:149183010-149183032 TTCAAAAGCCATTTGGAGGCAGG + Intronic
999174892 5:149625198-149625220 TTTAAAAAGCATTTGGGGCCAGG - Intronic
1001419463 5:171575511-171575533 TGCAAAAGGGATGTGGAGGCGGG - Intergenic
1001846044 5:174922471-174922493 TTTAAAACACAAGTTGAGGCCGG + Intergenic
1002456654 5:179349072-179349094 ATTGAACAGAATGTGGAGGCTGG + Intergenic
1003177476 6:3762739-3762761 TTTTAAAAGCACGTGGAGGCCGG - Intergenic
1003463284 6:6352266-6352288 TTTAAAAAGCATTCAGAGCCTGG - Intergenic
1003954681 6:11150597-11150619 TTTAAAAAGCAACTGCTGGCCGG - Intergenic
1004826267 6:19424817-19424839 TTTAAAAACCACCTGGAGGAAGG + Intergenic
1004995485 6:21187625-21187647 TTCCAAAAGCATGGGGAGTCAGG - Intronic
1005318670 6:24629888-24629910 TTTAAATAGCATGACAAGGCCGG + Intronic
1005634555 6:27740904-27740926 TTAAAAGAGCATAAGGAGGCCGG + Intergenic
1005699607 6:28387119-28387141 TTAAAAATAAATGTGGAGGCTGG - Intronic
1006087021 6:31603242-31603264 TTTAAAAAGAAAGTGGGGCCAGG - Intergenic
1006264733 6:32911049-32911071 TTTAAGAAGCATATGTAAGCTGG - Intergenic
1006495483 6:34420096-34420118 TTGAAAAAGCAAGTGGAAACAGG - Intronic
1006661793 6:35652724-35652746 ATCACAAAGCAAGTGGAGGCAGG - Intronic
1006704548 6:36007822-36007844 TTTAAAAATGGTGTTGAGGCTGG + Intronic
1006748149 6:36359544-36359566 TGTAAAAAACATGTGTAAGCAGG - Intronic
1007188318 6:39992077-39992099 TTTAAAAAGTATTTTTAGGCCGG - Intergenic
1007654160 6:43442146-43442168 TTTAAAAAGTATTTGTAGGCTGG + Intronic
1008939383 6:57030071-57030093 TTTAAAAACCATTTTCAGGCTGG + Intergenic
1009058018 6:58361854-58361876 ATTAAAAATCATGTGATGGCTGG - Intergenic
1009232811 6:61085246-61085268 GTTAAAAATCATGTGATGGCTGG + Intergenic
1009392379 6:63160001-63160023 ATTAAAAACAATGTGTAGGCTGG - Intergenic
1010340941 6:74751643-74751665 TTTAAAAAACATGTGTCGGCTGG - Intergenic
1010484180 6:76390034-76390056 TTTATAAAAGATGTTGAGGCTGG - Intergenic
1010830423 6:80521613-80521635 TTTATAACACATGTGGATGCTGG + Intergenic
1010858836 6:80878976-80878998 TTAAAAAAGCTTGTAGAGACAGG - Intergenic
1010965434 6:82200895-82200917 TTTAAAAAACATCTTTAGGCTGG - Intronic
1011732851 6:90283669-90283691 TTAAAAATGCATGAGGAGGCCGG - Intronic
1012116374 6:95303494-95303516 TTTAAAAAGATTTGGGAGGCCGG - Intergenic
1012420681 6:99061591-99061613 TTTAAAAACCAGATGGAGGAAGG - Intergenic
1012497441 6:99849452-99849474 TTTAAAAATAATATTGAGGCTGG - Intergenic
1012526437 6:100183485-100183507 TTCAAAAAGCATTTGAGGGCAGG + Intergenic
1013862319 6:114650518-114650540 TTAAAAAAGCCTGTGGACTCTGG + Intergenic
1015253236 6:131149336-131149358 TTTAGAAATGATGGGGAGGCTGG + Intronic
1015305447 6:131701582-131701604 TTTAAAAAATATATGCAGGCCGG + Intronic
1015316701 6:131824762-131824784 TTTTAAGAGCAATTGGAGGCCGG + Intronic
1015936684 6:138411784-138411806 TTTAAAAAACCTGTAGAGACAGG - Intronic
1016043365 6:139455765-139455787 GTTAAAAAGCTAGTGTAGGCCGG - Intergenic
1016181611 6:141154082-141154104 TTAAAATAGCATTTGTAGGCTGG + Intergenic
1016723452 6:147329921-147329943 TTAAAAAAGCCTGAAGAGGCCGG - Intronic
1016761098 6:147738512-147738534 TTTCAAATGCATGTTGAGGCTGG + Intergenic
1016896265 6:149056401-149056423 TTTGAAAAGCAGGGGTAGGCCGG - Intronic
1017161472 6:151369674-151369696 CTTAAAAAACAGGTGGAGGCTGG + Intronic
1017235631 6:152114593-152114615 ATTAAAAAGCAAGTCAAGGCCGG + Intronic
1017464093 6:154678574-154678596 TTTTAAAAGATTGTTGAGGCTGG + Intergenic
1017880860 6:158561356-158561378 TTTAAAAGCCAAGTGGAGGTAGG + Intronic
1018419887 6:163631839-163631861 TTTAAAAAGCCCCTGGCGGCCGG - Intergenic
1018680964 6:166264413-166264435 TGTATAAAGCATTTGGAGGCAGG + Intergenic
1018695027 6:166383905-166383927 TTTAAAATGCCTCTGGTGGCCGG + Intergenic
1019529877 7:1498040-1498062 TTTAAAAATTTTGTGGAGACCGG - Intronic
1020179063 7:5907153-5907175 ATTAGAAAGTAGGTGGAGGCGGG - Intronic
1020303870 7:6817716-6817738 ATTAGAAAGTAGGTGGAGGCCGG + Intronic
1020454567 7:8357014-8357036 TCTACAAAGCATGTTGAGGCTGG + Intergenic
1021035491 7:15793566-15793588 TTTAAAATGCTGGTGGAGCCTGG - Intergenic
1021426902 7:20510543-20510565 TCTAAAAATAATGTGGAGGCAGG - Intergenic
1021446983 7:20744326-20744348 TTTAAAGAACATGAGGAGACTGG - Intronic
1021592502 7:22279280-22279302 TTTAAAAAGCATCTACAGGTAGG - Intronic
1022036208 7:26537234-26537256 TTTAAAAAGGATGTGGAAAGAGG + Intronic
1022136287 7:27452378-27452400 TTTAAAAAGTTACTGGAGGCTGG + Intergenic
1022273511 7:28833286-28833308 TTTAAAAATCATGATGAGGCTGG - Intergenic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1022807131 7:33833676-33833698 AATAAAAAGCTTGTTGAGGCCGG - Intergenic
1024432410 7:49303999-49304021 CTTAAAATTCATATGGAGGCTGG - Intergenic
1024947789 7:54828548-54828570 TGTAAAATGCATTTGGAGGATGG - Intergenic
1025010871 7:55397163-55397185 TTTAAAAAGCAAAATGAGGCTGG + Intronic
1025115982 7:56258492-56258514 CTTAAAAAGCATGTGGATTCTGG + Intergenic
1025162147 7:56670499-56670521 TATAAAAAGCCTATGGGGGCTGG - Intergenic
1025839905 7:65136503-65136525 TTTAAAAAACATGATGAGGCCGG - Intergenic
1025883161 7:65559462-65559484 TTTAAAAAACATGATGAGGCCGG + Intergenic
1025890285 7:65643144-65643166 TTTAAAAAACATGATGAGGCCGG - Intergenic
1025949691 7:66134154-66134176 TGTAAAAATCCTGTAGAGGCTGG - Intronic
1026087261 7:67272565-67272587 TTTAAGAAGCAGGTGGCGGCAGG - Intergenic
1026200422 7:68209650-68209672 CTTAGAAAGCATGTGGATTCCGG + Intergenic
1026681951 7:72473634-72473656 TTCAAAAAGCATTTGAGGGCTGG + Intergenic
1026689839 7:72542136-72542158 TTTAAGAAGCAGGTGGCGGCAGG + Intergenic
1026904630 7:74056080-74056102 TTTAAAAAAAATGTGGGGCCGGG - Intronic
1026917302 7:74128537-74128559 CTAAAAATTCATGTGGAGGCTGG - Intergenic
1026922269 7:74164707-74164729 TTTAAAAAACATGAGGGAGCGGG + Intergenic
1027635440 7:80667129-80667151 TTTAAAAAGCAATGGGAGGCTGG + Intronic
1027740633 7:81999962-81999984 TTTAAAAACTATTTAGAGGCCGG + Intronic
1027968148 7:85040272-85040294 TATAAAAGGCATATGCAGGCTGG - Intronic
1028324148 7:89501579-89501601 TATAAAAAGCATTTGCAGCCAGG + Intergenic
1028397935 7:90392820-90392842 GTTTAAAAGAATCTGGAGGCCGG + Intronic
1028757361 7:94452957-94452979 TTAAGAAAGCTAGTGGAGGCTGG + Intergenic
1028859507 7:95632786-95632808 TTTCTAAAACATGTGGACGCAGG + Intergenic
1028964128 7:96782759-96782781 TTTAAAAGTCATATTGAGGCCGG + Intergenic
1029329681 7:99841691-99841713 ATTAAAAAAAATGTGTAGGCCGG - Intronic
1029401368 7:100348802-100348824 GTTAAAAAGGCTGTGTAGGCCGG - Intronic
1029781162 7:102735184-102735206 ATTAAAAAGTATTTTGAGGCTGG - Intergenic
1029909350 7:104128417-104128439 TTTAAAAACCATGTGTTGGCTGG - Intronic
1030338839 7:108354596-108354618 TTTAAAAAGCAATTTCAGGCTGG + Intronic
1030401913 7:109062411-109062433 TTTAAAAAGAATGTTAAGTCTGG - Intergenic
1030581071 7:111356728-111356750 TTTTAAAAGCATATATAGGCTGG + Intronic
1030763098 7:113375543-113375565 TTTAATAAGCATGAGATGGCAGG - Intergenic
1031093339 7:117389377-117389399 TTTAAAATGCATTTTGAGGCTGG - Intronic
1031097800 7:117441795-117441817 GTGAAAAATAATGTGGAGGCCGG - Intergenic
1031346964 7:120679711-120679733 TTTAAAAAGAATGTGGAACTTGG - Intronic
1031424902 7:121593688-121593710 TTTAGAAAGCAATTGGAAGCTGG - Intergenic
1031690145 7:124777959-124777981 TTTAATGAGGATGGGGAGGCAGG + Intronic
1031852194 7:126878864-126878886 TTTAAAAAACATGATGAGGCCGG + Intronic
1032118903 7:129142191-129142213 TTTAAAAAGCAAAATGAGGCCGG - Intergenic
1032207170 7:129877304-129877326 TTTAAAAAGAATGTTGAGATTGG + Intronic
1032606393 7:133358957-133358979 TTTAGAAAGCTTTTGTAGGCAGG + Intronic
1033059754 7:138094813-138094835 TTCAAAAAGCATGTGAAGTCAGG - Intronic
1033739559 7:144259809-144259831 TTTAAAAAATATATGCAGGCCGG + Intergenic
1034195933 7:149247278-149247300 TTTAAAAAAATTGTGGAGGTGGG + Intronic
1034587914 7:152112240-152112262 TTTAAAAAGCAAGTTTTGGCTGG + Intronic
1034595942 7:152192244-152192266 TTAAAACAGCATATGGGGGCTGG + Intronic
1035204042 7:157283041-157283063 TTTAAAACAGATCTGGAGGCCGG + Intergenic
1035417130 7:158699078-158699100 ATAATAAAGCAGGTGGAGGCTGG - Intronic
1035939471 8:3881337-3881359 TATAAAAAGCAAGTTGGGGCCGG + Intronic
1036150988 8:6298312-6298334 TTTAAAAAGCAATTGAATGCTGG + Intergenic
1036552375 8:9826735-9826757 TTACAAAAGCATGCGGAGGGCGG - Intergenic
1037096655 8:14994285-14994307 TTTAAGATGCATGAGGGGGCTGG + Intronic
1037204948 8:16305783-16305805 TTAAAAAATGCTGTGGAGGCTGG + Intronic
1037218320 8:16485120-16485142 TTTAAAAGGTAGGTGGAGTCTGG + Intronic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1037588485 8:20294478-20294500 TTTACAGTGCAGGTGGAGGCTGG + Intronic
1038056436 8:23862705-23862727 TTAGAAAAGCTTGTGGATGCTGG + Intergenic
1038221118 8:25608734-25608756 TTTAAAAATCAAGTCTAGGCTGG - Intergenic
1038344769 8:26722152-26722174 TTTAAAAAGTGTGTTAAGGCAGG - Intergenic
1038768155 8:30449665-30449687 TTTAAAAAGGAGGTGTGGGCCGG - Intronic
1040011953 8:42668742-42668764 TTTAAATAGCATTTCCAGGCAGG - Intergenic
1040107644 8:43549533-43549555 TTTCAGAAGGATGTTGAGGCAGG - Intergenic
1040784420 8:51148741-51148763 TTTAAAAGTCATATTGAGGCCGG - Intergenic
1040874278 8:52134025-52134047 CATAAAAATCATTTGGAGGCGGG - Intronic
1041054946 8:53974824-53974846 TTTAAAAAGCTGGAGTAGGCTGG - Intronic
1041162410 8:55059011-55059033 TTAAAAATGCATTTGGCGGCGGG + Intergenic
1041275707 8:56155762-56155784 ATTAAAAAGCAGGGGAAGGCCGG + Intergenic
1041786730 8:61642567-61642589 GTTAGAAAGCATTTGCAGGCCGG + Intronic
1042061752 8:64825355-64825377 TTAAAAAATCAGCTGGAGGCCGG - Intergenic
1042142452 8:65693010-65693032 TTTAAAAGGTATGTGTAGGCGGG - Intronic
1042340335 8:67672124-67672146 TTAAAAATGCATGAGAAGGCCGG - Intronic
1042429214 8:68685551-68685573 TTTAAAAAGCATGTTGATCCAGG + Intronic
1042751308 8:72161159-72161181 TTTAAATAGCATGTGTACCCAGG + Intergenic
1043028396 8:75100720-75100742 TTTAAAAAGCTTGTTGTGGGTGG - Intergenic
1043587576 8:81786855-81786877 TTTAAAAAATCTGTTGAGGCTGG - Intergenic
1043738309 8:83775136-83775158 ATGGAAAAGGATGTGGAGGCAGG - Intergenic
1044339819 8:91033939-91033961 TTTAAAAACAAGGAGGAGGCTGG - Intronic
1044689903 8:94866959-94866981 TTTTAATCGCATGTGGGGGCGGG - Intronic
1045265847 8:100618060-100618082 TTAAAAAATGGTGTGGAGGCCGG - Intronic
1045457742 8:102398484-102398506 GTTAAAAAGCTTCTGCAGGCTGG + Intronic
1045875806 8:106979528-106979550 TTTAAAAAGGTTTTAGAGGCCGG + Intergenic
1045893473 8:107185394-107185416 TATTAAAAGCATGGGCAGGCCGG - Intergenic
1046246689 8:111572787-111572809 TCTAAAAAGTATATGCAGGCTGG - Intergenic
1046564752 8:115884965-115884987 ATTAAGAAGCCTGTGGAGTCTGG + Intergenic
1046759513 8:118006995-118007017 TTTTAAAAGCATTTGATGGCTGG + Intronic
1047169808 8:122481210-122481232 TTTTAAAAGCCAGTGGTGGCAGG - Intergenic
1047273603 8:123387854-123387876 TTTAAAAAGCATGTTTGGGGGGG + Intronic
1047301196 8:123614774-123614796 TATGAAAAGAATGTGGCGGCTGG - Intergenic
1047550036 8:125861010-125861032 TTTAAAATGCATGTAGATGAAGG - Intergenic
1047789562 8:128189038-128189060 ATTAAAAAGCATGTTGAGCCAGG - Intergenic
1047836756 8:128702108-128702130 AGTAAAAAGAATGTGGAGGAAGG - Intergenic
1048085045 8:131168180-131168202 TATAAAAAGCAGGTGGTAGCCGG - Intergenic
1048707223 8:137167232-137167254 TTTAAAAAGTATGTTCAGGCAGG - Intergenic
1048831796 8:138484704-138484726 TTTCAAAAGCATGTGGATGTTGG - Intronic
1049973222 9:839421-839443 TTTAAAAATTTTGTGGAGACAGG - Intergenic
1050327573 9:4512214-4512236 TCTAAAATTCATATGGAGGCAGG + Intronic
1050661771 9:7890910-7890932 TTTAAAAAATCTGTTGAGGCTGG - Intergenic
1050826245 9:9950426-9950448 TTTAAGAAGAAAGTGGAGGCCGG + Intronic
1051142264 9:13990123-13990145 TTTAAAAAGTATTTCAAGGCCGG - Intergenic
1051210786 9:14740384-14740406 TTTAAAAAGTATCTGCAGGGTGG + Intronic
1051750781 9:20338893-20338915 TTTAAAAACGATTTTGAGGCTGG + Intergenic
1051805590 9:20989520-20989542 TTTAAAATGCATGAAGAAGCTGG + Intronic
1052739463 9:32379588-32379610 TTTAAAAAGCACTTAGAGCCAGG + Intergenic
1053080022 9:35167897-35167919 TTTAAAAACCATCTACAGGCTGG - Intronic
1053182575 9:35986435-35986457 TTTAAAAGACATTTGGGGGCCGG + Intergenic
1053315672 9:37049363-37049385 TTTAAGTAGCAATTGGAGGCTGG - Intergenic
1053320861 9:37097849-37097871 TAAAAAATACATGTGGAGGCCGG + Intergenic
1054759950 9:68995507-68995529 ATGAAAAAGCAAATGGAGGCCGG + Intronic
1055118504 9:72631660-72631682 TTTACAAAGCAAGTTGAGGGGGG + Intronic
1055279867 9:74661939-74661961 TTTAAAAAGAATTCCGAGGCCGG - Intronic
1056310246 9:85333673-85333695 TTTAAAAAGCATCTGGAATCAGG - Intergenic
1056923460 9:90812500-90812522 TTTAAGAAACATCTGAAGGCAGG - Intronic
1057055477 9:91957253-91957275 TTTAAAAATAATGTGTAGGCTGG + Intergenic
1057163755 9:92910169-92910191 TTTAAAAAGTATATTCAGGCTGG - Intergenic
1057323226 9:94033155-94033177 TTGAAAAAGGACGTGCAGGCTGG - Intronic
1057446392 9:95118312-95118334 TTTAAAAACCATGCTGAGCCAGG - Intronic
1057640216 9:96812468-96812490 TTTAAAACACTTTTGGAGGCTGG + Intergenic
1057777897 9:98025725-98025747 TTGAAATTGCACGTGGAGGCTGG + Intergenic
1057811404 9:98259633-98259655 TTTTAAAAGGATGTTAAGGCCGG + Intergenic
1057862486 9:98652550-98652572 TTTCTAGAGCATGAGGAGGCTGG - Intronic
1057927294 9:99164670-99164692 TTTAAAACTCCAGTGGAGGCTGG - Intergenic
1058379009 9:104358464-104358486 TTTAGAAAGCAAAAGGAGGCCGG + Intergenic
1058655202 9:107214063-107214085 TTTAAAATGCATGTGTGGCCGGG + Intergenic
1058665386 9:107309633-107309655 TTTAAAAACAATGTGTGGGCCGG + Intronic
1058670310 9:107355705-107355727 TGTAAAATGGAGGTGGAGGCTGG - Intergenic
1058872686 9:109216206-109216228 TTAAGAAAGGAGGTGGAGGCGGG + Intronic
1059177247 9:112178667-112178689 TTTAAAAAAAATGTAGAGACAGG + Intergenic
1059233744 9:112744851-112744873 CTTAAAAGGCATCTGAAGGCTGG - Intergenic
1060106544 9:120876659-120876681 TTTAAAAAGGATGTTCAGGAGGG + Intronic
1060853674 9:126898146-126898168 TTTAAAAACCAGGCAGAGGCTGG + Intergenic
1061161932 9:128900410-128900432 CTTTAAAAGCATTTGGGGGCTGG + Intronic
1061343956 9:130006935-130006957 GATATAAAGAATGTGGAGGCCGG + Intronic
1061350831 9:130063484-130063506 TTTAAAAAGCATGTTATAGCCGG - Intronic
1061736716 9:132665988-132666010 TTTAGAAAACATGTGTATGCTGG + Intronic
1062418353 9:136465725-136465747 TTTAAAACGCATGTCGGGGCAGG + Intronic
1186492144 X:9982196-9982218 TTAAAAAAGCTTGAGGTGGCCGG + Intergenic
1186792506 X:13012659-13012681 GATAAAAAGCATGTGTGGGCTGG + Intergenic
1187010582 X:15274321-15274343 TTTAAAATGCATTTTGAGGCTGG + Intergenic
1187118478 X:16379707-16379729 TAAAAAAAGCATATGGAGCCAGG + Intergenic
1187166102 X:16805277-16805299 TTTAAAAAGGGGGTGGAGGGCGG - Intronic
1187519722 X:20002881-20002903 TTTAAAATACATATTGAGGCCGG - Intergenic
1188211392 X:27429241-27429263 TTTGAAATGCCTGGGGAGGCTGG - Intergenic
1188593071 X:31863045-31863067 TTAAAACAGCATGTTGCGGCCGG + Intronic
1188787413 X:34365389-34365411 GGTAAAATGCATGTGGAGGAGGG - Intergenic
1189509542 X:41648408-41648430 ATTACAAGGCAAGTGGAGGCAGG - Intronic
1189779913 X:44504409-44504431 TTTAAAAAGCAGGTTATGGCCGG + Intergenic
1190051532 X:47153789-47153811 CTTTAAAAGCATCTGGAGGCTGG + Intronic
1190240661 X:48655409-48655431 TTTGAAATGGAGGTGGAGGCTGG + Intergenic
1190334559 X:49254425-49254447 TTTAAAAATAAAGTGGAGCCAGG - Intronic
1190466518 X:50730129-50730151 TTTAAAAAGCAATTGCAGGCTGG + Intronic
1190546151 X:51529854-51529876 TTTAAAAAGGAACTGTAGGCCGG + Intergenic
1190617766 X:52254186-52254208 TTTAAAAAGTATGGGTAAGCTGG - Intergenic
1191007016 X:55720542-55720564 TTTGAAAAGCAAGTTAAGGCTGG + Intronic
1192303893 X:69937629-69937651 TTTAAAAAACATGATGAGGAAGG - Intronic
1192864944 X:75120990-75121012 TTTAAAAAGCCTATGTAGGCTGG + Intronic
1194106833 X:89780000-89780022 TTTAAAAAACATGTGGAAGCAGG + Intergenic
1194301515 X:92192641-92192663 TTTAAAAAGAGAATGGAGGCCGG - Intronic
1194501121 X:94682444-94682466 TTTAAAAAAAATGTTTAGGCTGG + Intergenic
1195450245 X:105003367-105003389 TTTAAGAAGCATCTGGAGCAAGG - Intronic
1195638301 X:107143509-107143531 TTTAAAAGTGATTTGGAGGCTGG - Intronic
1195778290 X:108432537-108432559 CTTAAAAAACAAGAGGAGGCCGG + Intronic
1196248340 X:113427997-113428019 TTTAAAAACCAGGTAGTGGCTGG + Intergenic
1196388519 X:115186061-115186083 CTTAAAAAGCATATTCAGGCCGG + Intronic
1196468586 X:115998322-115998344 TATAAAAAGGATCTGGATGCTGG - Intergenic
1196795038 X:119495482-119495504 TTTAAAAAGCATGTATAGGCGGG - Intergenic
1197063139 X:122206345-122206367 TTTAAAAAACATGTGTAGGTAGG + Intergenic
1197214694 X:123857158-123857180 CTCAAACAGCATGTGGAGGCTGG - Intergenic
1197374198 X:125662347-125662369 TTAAAAAAGGATGTTCAGGCTGG - Intergenic
1197740973 X:129893663-129893685 TTTAAAAAACAGCTTGAGGCTGG - Intergenic
1198072661 X:133164824-133164846 ATCACAAAGCAAGTGGAGGCGGG + Intergenic
1198107170 X:133472952-133472974 TTTAAAGGGCATGTGGAGGCTGG + Intergenic
1198241030 X:134786217-134786239 TTTAAAAAGTATTTTGGGGCTGG + Intronic
1198475752 X:136996304-136996326 TTTAAAATGGATGTTGTGGCTGG + Intergenic
1198568781 X:137933523-137933545 ATAAAAATGCATGTGTAGGCTGG + Intergenic
1199000742 X:142633199-142633221 TTTAAAAACTATCTGAAGGCAGG + Intergenic
1199636670 X:149819972-149819994 TTTAAAAAGCAGTTGGGGCCAGG + Intergenic
1199715771 X:150506418-150506440 TTTATAAAGAATGTGGAGGAAGG - Intronic
1199866171 X:151852136-151852158 TTTGAATAGCATTTGGGGGCTGG - Intergenic
1200105957 X:153712575-153712597 TTTAAAAAGCATGTGGAGGCTGG + Intronic
1200958283 Y:8972645-8972667 TTCAGAAATCATGAGGAGGCTGG - Intergenic
1201054736 Y:9977312-9977334 TTTAAAAAGCAATTAGAAGCAGG + Intergenic
1201316757 Y:12654964-12654986 GTTAAAAAGCAATAGGAGGCAGG - Intergenic
1201694878 Y:16813731-16813753 TTTAAAAAACAAGTACAGGCCGG - Intergenic
1202604735 Y:26629168-26629190 ATTAAAAAACAAGTGGTGGCTGG + Intergenic