ID: 1200107855

View in Genome Browser
Species Human (GRCh38)
Location X:153724654-153724676
Sequence CTCCCGCACCACAGAGACGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200107855_1200107868 6 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107868 X:153724683-153724705 CGCCGAGGGGCGAGAACGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 80
1200107855_1200107870 9 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107870 X:153724686-153724708 CGAGGGGCGAGAACGGGAGGTGG 0: 1
1: 0
2: 3
3: 19
4: 356
1200107855_1200107871 10 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107871 X:153724687-153724709 GAGGGGCGAGAACGGGAGGTGGG 0: 1
1: 0
2: 0
3: 30
4: 440
1200107855_1200107877 22 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107877 X:153724699-153724721 CGGGAGGTGGGGGTGTGGGCGGG 0: 1
1: 1
2: 19
3: 217
4: 1835
1200107855_1200107875 18 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107875 X:153724695-153724717 AGAACGGGAGGTGGGGGTGTGGG 0: 1
1: 1
2: 1
3: 63
4: 667
1200107855_1200107861 -8 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107861 X:153724669-153724691 TGCGGGAGGGGCCCCGCCGAGGG 0: 1
1: 0
2: 1
3: 8
4: 114
1200107855_1200107873 12 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107873 X:153724689-153724711 GGGGCGAGAACGGGAGGTGGGGG 0: 1
1: 1
2: 0
3: 44
4: 571
1200107855_1200107872 11 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107872 X:153724688-153724710 AGGGGCGAGAACGGGAGGTGGGG 0: 1
1: 0
2: 2
3: 60
4: 722
1200107855_1200107876 21 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107876 X:153724698-153724720 ACGGGAGGTGGGGGTGTGGGCGG 0: 1
1: 0
2: 26
3: 207
4: 1698
1200107855_1200107863 2 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107863 X:153724679-153724701 GCCCCGCCGAGGGGCGAGAACGG 0: 1
1: 0
2: 0
3: 3
4: 85
1200107855_1200107865 3 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107865 X:153724680-153724702 CCCCGCCGAGGGGCGAGAACGGG 0: 2
1: 0
2: 1
3: 5
4: 70
1200107855_1200107862 -7 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107862 X:153724670-153724692 GCGGGAGGGGCCCCGCCGAGGGG 0: 1
1: 0
2: 2
3: 25
4: 240
1200107855_1200107860 -9 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107860 X:153724668-153724690 GTGCGGGAGGGGCCCCGCCGAGG 0: 1
1: 0
2: 1
3: 17
4: 212
1200107855_1200107874 17 Left 1200107855 X:153724654-153724676 CCCACGTCTCTGTGGTGCGGGAG 0: 1
1: 0
2: 0
3: 3
4: 76
Right 1200107874 X:153724694-153724716 GAGAACGGGAGGTGGGGGTGTGG 0: 1
1: 0
2: 18
3: 137
4: 1260

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200107855 Original CRISPR CTCCCGCACCACAGAGACGT GGG (reversed) Intronic
900341991 1:2193908-2193930 CTCCTGCAACACAGAGTTGTTGG + Exonic
900436197 1:2632332-2632354 CACCCCCACCCCAGAGACCTCGG + Intronic
901242341 1:7702959-7702981 CTCCCGCACCATAGATATGAAGG + Intronic
915934481 1:160082687-160082709 CTCCCACTCCACGGAAACGTGGG - Intronic
917865495 1:179190576-179190598 TCCCCCCTCCACAGAGACGTGGG + Intronic
922440814 1:225653505-225653527 CTCCCGCTCCCCAGAGGCTTGGG + Intergenic
1077872469 11:6273429-6273451 CTCCCACCCCACAGAGAAGCTGG - Intergenic
1079407017 11:20156440-20156462 CACCCGGACCTCAGCGACGTGGG - Exonic
1081856760 11:46308793-46308815 CTGCCCCACCACAGACCCGTGGG + Intronic
1084109160 11:67002381-67002403 CACCCGCAGCACAGAGACACTGG + Intergenic
1088597180 11:111449357-111449379 CTCCCGGGCCACCGAGACTTTGG + Intronic
1089301551 11:117501987-117502009 CTCACGCACCACACACACGCTGG - Intronic
1092126222 12:6076909-6076931 GTCCGGCAGCACAGGGACGTTGG + Intronic
1093504682 12:19851512-19851534 CTCACCCACCACAGAAACATCGG + Intergenic
1101138919 12:101775010-101775032 CTCCCGAAGGACAGAGACCTGGG + Intronic
1111881328 13:93960713-93960735 CTTCAGCATCACAGAGACCTAGG - Intronic
1113937428 13:114001812-114001834 CTCCCGCACAACACAGGTGTGGG - Intronic
1125720079 15:41841168-41841190 TTCCCACCCCACAGAGACCTGGG - Intronic
1129423706 15:75450753-75450775 CTCCCTCCCCACGGAGACATAGG + Intronic
1130554816 15:84915228-84915250 CTTCCCCACCACAGGGAAGTTGG + Intronic
1131067306 15:89442577-89442599 CCCCCACCCCACAGAGACTTAGG - Intergenic
1131457324 15:92592113-92592135 ATCCCCCATCACAGAGAAGTAGG + Intergenic
1131745284 15:95440827-95440849 CTCCCTCACCACAAAGACTTCGG - Intergenic
1136508484 16:30721484-30721506 GTCCCTCACCACAGAGCCCTGGG - Intronic
1138599845 16:58047824-58047846 CTCCCCCACCACAGGGGCCTTGG + Intergenic
1139570309 16:67807312-67807334 CTCCAGCACCACAGAGTCAATGG + Exonic
1148603009 17:48908414-48908436 CTCCCGCACCACCGAGAACCGGG - Exonic
1150711124 17:67531756-67531778 CTCCCCCATCCCAGAGGCGTCGG + Intronic
1152408789 17:80111819-80111841 CGCCAGCCCCACAGAGGCGTGGG + Intergenic
1160503149 18:79412066-79412088 CTCCTGCTCCCCAGAGACGCCGG + Intronic
1161818456 19:6515074-6515096 CTCCGGCACCACCAAGATGTTGG - Intergenic
927653474 2:24926724-24926746 CACCCGCACAACAGGGACGCCGG - Intergenic
929996827 2:46832170-46832192 CTCCCGCACTACAGACATTTTGG - Intronic
936507863 2:113122393-113122415 CTGCCGCACCCCAGAGAGGCAGG - Intronic
936617844 2:114066699-114066721 CTCCCTCACCAGAGGGACTTAGG - Intergenic
939545300 2:143544836-143544858 CTTCTGCTCCACAGAGAGGTGGG - Intronic
944055974 2:195522365-195522387 TTCCCCCACCACAGAGAACTAGG + Intergenic
945147647 2:206755274-206755296 ATCCAGCACCACAATGACGTGGG + Exonic
946226082 2:218264823-218264845 CTCCCTCATGACTGAGACGTGGG + Intronic
948884861 2:240877461-240877483 CTCCCGCACCACAGAGGGCGGGG + Intronic
949058492 2:241942982-241943004 CTCCTGGCCCACAGAGCCGTGGG - Intergenic
1169088207 20:2840340-2840362 CTCCCGCCCCGCAGAGACCGTGG + Exonic
1172233398 20:33352461-33352483 GTCCCGCACCACAGTGGAGTTGG + Intergenic
1174296337 20:49547951-49547973 CTCCCACACCACCGCGTCGTAGG + Exonic
1177651434 21:23965441-23965463 CTCCAGCACCACAAAGACTGGGG + Intergenic
1181644957 22:24226117-24226139 CTCCCCCAGCACAGACACATGGG + Exonic
1182535037 22:30994698-30994720 CTCCAGCACCAGAGAGATGAAGG + Intergenic
1182605097 22:31496790-31496812 TTCCCGCACCACAGACCCGCAGG - Intronic
1184379113 22:44134102-44134124 CTCCCCGACCACAGAGACCACGG - Intronic
1184678632 22:46057292-46057314 CTCCTGGACCAAAGAGACCTAGG - Intronic
1185012574 22:48322534-48322556 CTCCCGCCCCCCAGACACCTGGG - Intergenic
951140053 3:19148285-19148307 CTCCCAGACCCCAGAGACGTCGG + Intergenic
953136806 3:40188872-40188894 CTCCCACCCCACAGACACGTGGG + Intronic
955499371 3:59569140-59569162 GTCCTGCACCAGACAGACGTGGG + Intergenic
962017403 3:131455963-131455985 CTCCTGGACCACAGAAACTTGGG + Intergenic
963084931 3:141427827-141427849 CTCCCCCACCACAAGGATGTAGG - Intronic
975679963 4:76866900-76866922 CTACCGAACCACAGAGATGGCGG - Intergenic
985426853 4:189839741-189839763 CTCCCTCTCCACAGAGACAAAGG + Intergenic
987216385 5:15742220-15742242 CTCCCCCACCACACAGAGGGAGG - Intronic
988688589 5:33549520-33549542 CTCCCACACCACAGAGCAGGAGG + Intronic
996403702 5:123087735-123087757 CTCCGGGACCACAGCGCCGTGGG + Intergenic
997226620 5:132214022-132214044 CTGCCGCTGCACAGAGAGGTTGG + Exonic
999802347 5:155049784-155049806 CTTCCTCACCACAGAGAGGCTGG + Intergenic
1006578647 6:35064007-35064029 CTCCCTCACCAGAGACAGGTTGG - Intronic
1012559452 6:100561502-100561524 GACCCGCACCAAAGTGACGTGGG - Intronic
1013448255 6:110252805-110252827 CACCCCCACCACTGAGACATGGG + Intronic
1015867080 6:137738367-137738389 CTCCAGCAGCACAGAAATGTGGG + Intergenic
1018731814 6:166657066-166657088 CACCCCCAACACAGAGACGGTGG + Intronic
1034282953 7:149866220-149866242 CTCCCGCACCACAGGCCTGTGGG - Exonic
1039435005 8:37553882-37553904 CTCCCGCAACACACACACGGTGG + Intergenic
1039895303 8:41712934-41712956 CTCCCTCTGCACAGCGACGTGGG + Intronic
1049231852 8:141488700-141488722 CTCCCGCGCCCCACAGAGGTAGG - Intergenic
1049635183 8:143684405-143684427 AGCGCGCACCACCGAGACGTGGG + Intergenic
1049713572 8:144078678-144078700 CTCCCGCGGCTCAGAGAAGTAGG + Exonic
1056154019 9:83817456-83817478 CTCCGGCACCCCGGAGGCGTAGG - Intronic
1185779260 X:2830330-2830352 CTCCAGCCCCAGAGAGACCTGGG - Intronic
1199013412 X:142783207-142783229 CACCCTCACCAAAGTGACGTGGG + Intergenic
1199628328 X:149760028-149760050 CTCCCACATCTCAGAGAGGTAGG - Intergenic
1200107855 X:153724654-153724676 CTCCCGCACCACAGAGACGTGGG - Intronic
1201290787 Y:12420159-12420181 CTCCAGCCCCAGAGAGACCTGGG + Intergenic