ID: 1200108620

View in Genome Browser
Species Human (GRCh38)
Location X:153727568-153727590
Sequence AAGTAGCACGTTGGCCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200108620 Original CRISPR AAGTAGCACGTTGGCCAAGA GGG Intronic
901869034 1:12126683-12126705 AAGGAGCACATGGGGCAAGAGGG + Intronic
904086351 1:27911893-27911915 TTGTACCATGTTGGCCAAGATGG - Intronic
912351813 1:109021152-109021174 AAGTAACATGTTTGCCAAAATGG - Intronic
915832728 1:159146154-159146176 AAGTATCTCTTTGGTCAAGAAGG + Intronic
921495719 1:215838756-215838778 AAGGAACACGTTAACCAAGAGGG + Intronic
924788016 1:247218665-247218687 AAGTGGGACTTTGGCCGAGAGGG + Intergenic
924804896 1:247354343-247354365 AAGTGGGACTTTGGCCGAGAGGG + Intergenic
1064933949 10:20659108-20659130 AAGGAGAACTTTGACCAAGATGG - Intergenic
1065510344 10:26472068-26472090 ATGCAGAACGTTGACCAAGATGG + Intronic
1068422702 10:56817305-56817327 GAGCAGCACGATGGCAAAGAAGG - Intergenic
1072284318 10:93898272-93898294 AAGTAGAACGCTTGCCAAGATGG - Intronic
1072752712 10:97994752-97994774 AAGTAGCCCTTTGGCCACTAGGG - Intronic
1080350366 11:31378075-31378097 AATTACCACGTTGGAAAAGAAGG + Intronic
1086740871 11:90367351-90367373 AAGGAGAAAGTTGGCCAAGCTGG - Intergenic
1088592275 11:111414174-111414196 AAGTTGCACATGGGCCAGGATGG + Intronic
1094837744 12:34330084-34330106 AAGTGGCAAGAGGGCCAAGAAGG - Intergenic
1095105087 12:38223843-38223865 AAATAGCATGTTATCCAAGAAGG - Intergenic
1100592833 12:96045308-96045330 CAGGAGCATGTTGGCCAACATGG + Intergenic
1107623672 13:42260229-42260251 AAGTGGCACATTGGTCAAGTTGG + Intergenic
1108883243 13:55147409-55147431 AGGGATCACCTTGGCCAAGAAGG - Intergenic
1108894677 13:55310397-55310419 AGGGAGCAAGTTGGGCAAGATGG - Intergenic
1108935937 13:55879700-55879722 AAGTAGGACTCTGGCCGAGAAGG - Intergenic
1116054614 14:39848177-39848199 AAATAGCATGTTGGCCAGGATGG - Intergenic
1129033978 15:72638874-72638896 GATCAGCACGCTGGCCAAGATGG + Intergenic
1129215904 15:74098342-74098364 GATCAGCACGCTGGCCAAGATGG - Intergenic
1129408895 15:75338112-75338134 AATCAGCACGCTGGCCAAGATGG + Exonic
1129733045 15:77942674-77942696 GATCAGCACGCTGGCCAAGATGG - Intergenic
1132484609 16:184209-184231 CAGAACCACGTTGGCCAGGATGG - Intergenic
1140801312 16:78491017-78491039 AAGCATGAAGTTGGCCAAGAGGG - Intronic
1141262443 16:82466304-82466326 TACTACCACGTTGGCCAGGATGG - Intergenic
1142214589 16:88824394-88824416 ATGTAGCACCTGGGCCAAGCAGG + Intronic
1147452501 17:40514546-40514568 AAGTGGCATGTTGGCAATGATGG + Intergenic
1148093391 17:45035976-45035998 AAGTACCACTCTTGCCAAGAAGG + Intronic
1148446417 17:47740536-47740558 GAGTTTCACGTTGGCCAAGCTGG - Intronic
1152143758 17:78554940-78554962 TATTAGCACGTTGGCCAGGCTGG + Intronic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1155278389 18:24212253-24212275 TAGTAGAATGTTGGCCAGGATGG + Intronic
1161231997 19:3179085-3179107 CAGCAGCACGTTGGCCAGGTAGG - Exonic
1161604724 19:5208258-5208280 AAGGAGCAGTTTGGCCAGGACGG - Exonic
1164624963 19:29721153-29721175 AAGTACCAGGTTACCCAAGATGG + Intergenic
1168439951 19:56356079-56356101 AAGTACCACATTGTCCCAGAAGG + Intronic
930344550 2:50163512-50163534 CAGAAGCACATTGGCCAAGAAGG - Intronic
930751947 2:54942992-54943014 AAGTCCCACGTTGGCACAGATGG + Intronic
933960460 2:87405278-87405300 AAAGAGCACCTTGGCCAACATGG + Intergenic
934244536 2:90295980-90296002 AAAGAGCACCTTGGCCAACATGG + Intergenic
934264315 2:91501492-91501514 AAAGAGCACCTTGGCCAACATGG - Intergenic
934506180 2:94896583-94896605 AAGCAGTACGTAGACCAAGAGGG + Intergenic
935183040 2:100707040-100707062 AAGTCTGACGTTTGCCAAGAAGG - Intergenic
939662168 2:144903594-144903616 GAGTAGAAAATTGGCCAAGATGG - Intergenic
941711468 2:168718652-168718674 AAGAAAAACGTTGACCAAGAGGG + Intronic
943158802 2:184219624-184219646 AGGGAGGACGTGGGCCAAGATGG - Intergenic
945683462 2:212940249-212940271 AAGCAGCAAGTTGGCAAATATGG - Intergenic
948036437 2:234862003-234862025 AAGGAGCGCGTGGGCCAAGCAGG + Intergenic
1171565214 20:26177929-26177951 AAGATGCACGTTGGAGAAGAGGG + Intergenic
1174450139 20:50614861-50614883 AGGTTTCACGTTGGCCAAGCTGG - Intronic
1175083884 20:56443284-56443306 TAGTACCACGTTGGCCAGGCTGG - Intronic
1176985780 21:15433982-15434004 AAGTAGCAAATTGGTCGAGAGGG + Intergenic
1179660814 21:42873748-42873770 AATTACCACGCTGGCCAACAAGG - Intronic
1179674563 21:42973307-42973329 AAGCAGCAGGGTGGGCAAGAGGG - Intergenic
1182631596 22:31690242-31690264 TTTTATCACGTTGGCCAAGATGG + Intronic
954169675 3:48791089-48791111 TTTTACCACGTTGGCCAAGATGG - Intronic
954671968 3:52296023-52296045 AATGAGCAAGTTGGGCAAGAAGG + Intergenic
956053530 3:65274978-65275000 CAATAGCAAGTTGGCCAACAGGG + Intergenic
964205257 3:154167358-154167380 AAGTAGGACCTTGGCCTGGATGG + Intronic
964506754 3:157407995-157408017 AAGTAACACGGTGACTAAGAGGG - Intronic
968257690 3:197292420-197292442 AAGCAGCACGTTGGTCACAAGGG + Intronic
971985929 4:33823742-33823764 AAGATGCACGTTGGAGAAGAGGG - Intergenic
973579686 4:52331109-52331131 ATGCAGCACCTTGGCCTAGATGG + Intergenic
973784565 4:54322996-54323018 AAGTGGCAAGTTGGCCACAAGGG + Intergenic
977273308 4:94945111-94945133 ATTTAGCACATTGGCTAAGAAGG + Intronic
977578199 4:98697058-98697080 TAGGAGCCCTTTGGCCAAGAGGG - Intergenic
983554612 4:169048912-169048934 AACTAGCTAGTTAGCCAAGAGGG + Intergenic
990321078 5:54630450-54630472 AAGCAGCACTTTCGCCAAGATGG - Intergenic
993049343 5:82908590-82908612 TTGCACCACGTTGGCCAAGATGG - Intergenic
996322596 5:122235795-122235817 AAGTACCATGTTGGCCAGGCTGG + Intergenic
997379049 5:133422145-133422167 AAGAAGGACGTGGGCAAAGATGG + Intronic
1005152212 6:22765332-22765354 AACTAGGACCTTGACCAAGATGG - Intergenic
1008056419 6:46950467-46950489 AAAGAGGAGGTTGGCCAAGATGG - Intronic
1011818877 6:91227013-91227035 TAGTAGCATGTTGGCCAGGATGG - Intergenic
1016357302 6:143232531-143232553 AAGAAGCATCTTGGCAAAGAAGG - Intronic
1017200493 6:151748693-151748715 ACCTACCACATTGGCCAAGATGG - Intronic
1018916643 6:168136403-168136425 AAGCAGCACGATGAACAAGAAGG + Intergenic
1023954760 7:44875564-44875586 TATTACCATGTTGGCCAAGATGG - Intergenic
1024205523 7:47156483-47156505 AAGTAGAACGGTGGCCACCAGGG + Intergenic
1025272240 7:57533929-57533951 AAGATGCACGTTGGAGAAGAGGG - Intergenic
1026875501 7:73877010-73877032 AATTCGCACCTCGGCCAAGAGGG + Intergenic
1042777061 8:72444219-72444241 AAGTGGTAGGTTGGCCAAGTTGG + Intergenic
1048694897 8:137015238-137015260 AAATAACACGTAGGCCAAGTAGG - Intergenic
1053598042 9:39584094-39584116 TAGTACCATGTTGGCCAAGCTGG + Intergenic
1185480320 X:441418-441440 TTTTACCACGTTGGCCAAGATGG - Intergenic
1189617297 X:42796856-42796878 AAGTATTACTTTGGCTAAGAAGG + Intergenic
1193206046 X:78748968-78748990 AAGTTGCACTCTTGCCAAGAAGG + Intronic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1198307896 X:135400622-135400644 AAGCAGCAGGTAGGGCAAGAAGG + Intergenic
1200108620 X:153727568-153727590 AAGTAGCACGTTGGCCAAGAGGG + Intronic