ID: 1200109813

View in Genome Browser
Species Human (GRCh38)
Location X:153734662-153734684
Sequence CACTGATGTCGCCCCTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 108}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200109813_1200109822 3 Left 1200109813 X:153734662-153734684 CCCCAGGAGGGGCGACATCAGTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1200109822 X:153734688-153734710 CAGGACAGAGGGCCGGTGGAAGG 0: 1
1: 0
2: 2
3: 35
4: 350
1200109813_1200109818 -9 Left 1200109813 X:153734662-153734684 CCCCAGGAGGGGCGACATCAGTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1200109818 X:153734676-153734698 ACATCAGTGGTGCAGGACAGAGG 0: 1
1: 0
2: 2
3: 15
4: 210
1200109813_1200109821 -1 Left 1200109813 X:153734662-153734684 CCCCAGGAGGGGCGACATCAGTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1200109821 X:153734684-153734706 GGTGCAGGACAGAGGGCCGGTGG 0: 1
1: 0
2: 1
3: 52
4: 379
1200109813_1200109820 -4 Left 1200109813 X:153734662-153734684 CCCCAGGAGGGGCGACATCAGTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1200109820 X:153734681-153734703 AGTGGTGCAGGACAGAGGGCCGG 0: 1
1: 1
2: 7
3: 32
4: 430
1200109813_1200109823 9 Left 1200109813 X:153734662-153734684 CCCCAGGAGGGGCGACATCAGTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1200109823 X:153734694-153734716 AGAGGGCCGGTGGAAGGAGCTGG 0: 1
1: 0
2: 4
3: 44
4: 418
1200109813_1200109819 -8 Left 1200109813 X:153734662-153734684 CCCCAGGAGGGGCGACATCAGTG 0: 1
1: 0
2: 0
3: 7
4: 108
Right 1200109819 X:153734677-153734699 CATCAGTGGTGCAGGACAGAGGG 0: 1
1: 0
2: 1
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200109813 Original CRISPR CACTGATGTCGCCCCTCCTG GGG (reversed) Intronic
900356640 1:2268189-2268211 CGCTGCTGTCGCCCATCCTTGGG + Intronic
901760306 1:11466807-11466829 CAGTGAGGTCGCCCCTCCACAGG - Intergenic
902943191 1:19815017-19815039 CACCGCTGTGGCCCCTGCTGGGG - Exonic
905950919 1:41949861-41949883 CATTGAAGGCACCCCTCCTGAGG + Intronic
910166196 1:84329835-84329857 CAGTGATGTCGCTACTCCTTGGG + Intronic
910591480 1:88931439-88931461 CATTGAAGGCACCCCTCCTGAGG + Intergenic
912463482 1:109853085-109853107 CATTGAAGGCCCCCCTCCTGAGG - Intergenic
915401114 1:155622500-155622522 CACTGAAGACTCCCCTCCTGAGG - Intergenic
920280891 1:204842844-204842866 CACTGATGGCCCCACTGCTGAGG - Intronic
922788078 1:228293395-228293417 CACGGCTGTTGCCCCTTCTGTGG - Exonic
922789544 1:228303717-228303739 CACAGCTGTGGCCCCTTCTGTGG - Exonic
924569574 1:245226098-245226120 CACTGCTGCTGCCCCTCGTGGGG - Intronic
1063335936 10:5213310-5213332 CACCCATGCTGCCCCTCCTGTGG - Intronic
1067456698 10:46424259-46424281 CACTGATGGCCTCCCTCCTCTGG - Intergenic
1067630503 10:47960380-47960402 CACTGATGGCCTCCCTCCTCTGG + Intergenic
1069560189 10:69423674-69423696 CACTGATGTTGCCCCTGGGGTGG + Intergenic
1072471460 10:95717799-95717821 CATTGAAGGCACCCCTCCTGAGG - Intronic
1076148134 10:128141424-128141446 CACAGCTGTAGCCCCTACTGGGG - Intergenic
1077407251 11:2388250-2388272 CACTCCTGTCTCCCCTCCTCCGG - Intronic
1079347406 11:19665049-19665071 CACTTATGTCGCATTTCCTGTGG + Intronic
1080730116 11:34941874-34941896 CTCTGCTCTGGCCCCTCCTGGGG + Intronic
1085852695 11:80140014-80140036 CACTGATGCAGCCCATCCTTAGG + Intergenic
1087842634 11:102935823-102935845 CACTTATGAGGCCCCTCCTCTGG - Intergenic
1088930577 11:114347310-114347332 CACTGAAGACTCCCCTCCCGAGG - Intergenic
1091358678 11:134957653-134957675 CACTGATCTTGCCCCTCCGCTGG + Intergenic
1101841487 12:108330700-108330722 CAATGAGGTAGCCCCTCTTGGGG + Intronic
1101882300 12:108633835-108633857 CACTGCTGTGGCACCCCCTGCGG + Intronic
1104851052 12:131874078-131874100 CATTGAAGACACCCCTCCTGAGG - Intergenic
1106519112 13:30481616-30481638 CACTGATTTTGCCCCACCGGGGG - Intronic
1112445647 13:99462137-99462159 AACTCATGTCCCCCCTCCTCTGG - Intergenic
1114620389 14:24093103-24093125 GTCTGATGTCACCCCTCTTGGGG - Intronic
1115417367 14:33152023-33152045 GAGTGATTTTGCCCCTCCTGAGG + Intronic
1116446687 14:45019923-45019945 CACTGAAGTCACCCCTCCCGAGG - Intronic
1122476130 14:102010657-102010679 TACTGATCACGCACCTCCTGGGG + Intronic
1125147225 15:36485878-36485900 CACTGCTGTCGCCCCTCAAGAGG + Intergenic
1126628940 15:50714246-50714268 TCCTGATGTCTGCCCTCCTGGGG + Intronic
1131175419 15:90206244-90206266 CTCTGATGTGGCCCTCCCTGGGG + Intronic
1131366740 15:91847826-91847848 CACAGCTGTCTGCCCTCCTGAGG - Intergenic
1132330980 15:101012578-101012600 CCCTGATGGGGCCCCTTCTGGGG - Intronic
1132686811 16:1165673-1165695 CGCTGGGGTCACCCCTCCTGAGG + Intronic
1133040230 16:3056753-3056775 CACCGATGGGGCCCCTCCTCTGG - Intronic
1137385549 16:48039260-48039282 AAGTGATGTTGCCCTTCCTGGGG - Intergenic
1140127477 16:72130375-72130397 CACTGAAGTCTGTCCTCCTGTGG - Intronic
1142380244 16:89727896-89727918 CACTGATGAGGTCCCTTCTGAGG - Intronic
1146495083 17:33314535-33314557 CACTGAAGTCTGCCCTTCTGGGG + Intronic
1147033580 17:37662376-37662398 TACTGTTCTCGCCCCTCCTGGGG - Intergenic
1147609232 17:41791975-41791997 CACTGGTGCCGCTGCTCCTGGGG - Intergenic
1151878485 17:76880720-76880742 CACTGCAGTCTCCCCACCTGGGG - Intronic
1154496274 18:14963565-14963587 CACTGATCTTGCCCCTCCACTGG - Intergenic
1161644359 19:5444094-5444116 CACTGATCTCGTCTCCCCTGAGG + Intergenic
1162193112 19:8962640-8962662 CACTGATGGAGTCCCTGCTGAGG + Exonic
927211738 2:20642940-20642962 CACTGCGGTGCCCCCTCCTGCGG + Intronic
935649453 2:105369915-105369937 CACTGCTGTCGCCATGCCTGAGG - Intronic
936032723 2:109085221-109085243 CACTGATGTGCCCCCTGCTATGG - Intergenic
940612371 2:156007068-156007090 CAGTGATGTCGCCCCTGCCCTGG - Intergenic
944310767 2:198231537-198231559 TACTGACTTCTCCCCTCCTGAGG - Intronic
948425815 2:237886072-237886094 CCCTGAGGACGCCACTCCTGTGG + Intronic
948882568 2:240867819-240867841 CAAGGATGTCCTCCCTCCTGAGG - Intergenic
1169924832 20:10771997-10772019 CACTGATATCTCCACTCATGGGG + Intergenic
1170826431 20:19800095-19800117 CACTGCTGTTGCCCCGTCTGAGG + Intergenic
1180834923 22:18925129-18925151 CACTGATGACACCATTCCTGCGG + Exonic
1182282109 22:29223963-29223985 CAGTGATGTCTCCCCTCCCCAGG + Intronic
1182743486 22:32586889-32586911 GACTGATGTATCCCCTCCCGAGG + Intronic
1184416059 22:44352544-44352566 CACTGGTGCCCCTCCTCCTGGGG + Intergenic
1203285012 22_KI270734v1_random:150428-150450 CACTGATGACACCATTCCTGCGG + Intergenic
950681531 3:14588521-14588543 CACTGATGTGTACCCTTCTGGGG + Intergenic
951810077 3:26689037-26689059 CACTGAGGTCTCTCCACCTGTGG - Intronic
952878968 3:37971179-37971201 CACTGCAGACGCCCCTCCTAAGG - Intronic
952939277 3:38429525-38429547 CACAGATGTGGCTTCTCCTGAGG + Intergenic
956684359 3:71810519-71810541 TACTGATGCTGCCCTTCCTGAGG - Intergenic
960863859 3:122180999-122181021 CCCTGATGTAGCTCCTCCAGTGG + Intergenic
961107896 3:124257788-124257810 CACTGTTCTTTCCCCTCCTGAGG + Intronic
961646465 3:128395292-128395314 CACTGATGGCTGCCCTGCTGAGG - Intronic
961745094 3:129059553-129059575 CACTGATGTCACACCTGCTCGGG - Intergenic
968618463 4:1592876-1592898 CCCTGCAGACGCCCCTCCTGCGG - Intergenic
969673533 4:8602605-8602627 CACTGCTGTCACCCTTCCCGAGG - Intronic
975313299 4:72926534-72926556 CATTGAAGGCACCCCTCCTGAGG - Intergenic
989688355 5:44114163-44114185 CATTGAAGTCACCCCTCCCGAGG + Intergenic
991907987 5:71531218-71531240 CACTCATGTCACCCCAGCTGCGG - Intronic
993590880 5:89794137-89794159 CATCGAAGTCACCCCTCCTGAGG + Intergenic
994096810 5:95854577-95854599 CACTGATGCCTCCCATCCAGAGG - Intronic
999744122 5:154578560-154578582 CCCTAAAGTCACCCCTCCTGAGG - Intergenic
1012603839 6:101132494-101132516 CAATGCTGTGGCCCCTCCTTAGG + Intergenic
1013137925 6:107300286-107300308 CATTGAAGGCACCCCTCCTGAGG + Intronic
1014057345 6:117031884-117031906 CACTGAAGTGGGCCCTACTGGGG - Intergenic
1016794623 6:148104909-148104931 CACTGATGTCGCCAATCTGGGGG + Intergenic
1017124555 6:151052951-151052973 CACTGAGATCGCCCGTCGTGGGG + Intronic
1017135219 6:151142007-151142029 CACTGAAGGCACTCCTCCTGGGG - Intergenic
1017906961 6:158763336-158763358 GACTGAAGTCGCCAGTCCTGAGG + Exonic
1023439084 7:40168332-40168354 CACCGAAGGCACCCCTCCTGAGG - Intronic
1023765989 7:43511227-43511249 CACTGATGTTCTCCCTCATGTGG + Intronic
1024603732 7:51008659-51008681 TGCTGATGTAGTCCCTCCTGGGG + Intergenic
1025073621 7:55923498-55923520 CTCTGAAGTCTCCCCTCCAGAGG + Intronic
1029192009 7:98778549-98778571 CTCTCAGGACGCCCCTCCTGAGG - Intergenic
1031084109 7:117285364-117285386 CACTGATGTGGCCAATGCTGAGG + Intronic
1031471924 7:122176678-122176700 CATTGAAGTCACCCCTCCTGAGG + Intergenic
1034276822 7:149827505-149827527 CACTGATGTCTCACCCTCTGGGG - Intergenic
1034410878 7:150941534-150941556 CATGGACGTCGCCGCTCCTGAGG - Intergenic
1034415338 7:150961660-150961682 CACCACTGTCGCCCCTGCTGTGG - Intronic
1035636107 8:1145447-1145469 CACTGTGGTCTCCCGTCCTGTGG + Intergenic
1036395856 8:8370762-8370784 TACTGATGTGGCCACTTCTGTGG + Intronic
1038828579 8:31033257-31033279 CACCGCAGCCGCCCCTCCTGCGG + Exonic
1039398321 8:37246646-37246668 CACTGCTCTCTCTCCTCCTGAGG - Intergenic
1042364702 8:67923172-67923194 CATTGAAGTCACCCCTCCTGAGG + Intergenic
1042910623 8:73822144-73822166 CATTGAAGGCACCCCTCCTGAGG + Intronic
1043394347 8:79822122-79822144 CATTGATGGAGCCCCTCCTATGG - Intergenic
1048302469 8:133261573-133261595 CATTGATGGAGCCCTTCCTGTGG - Intronic
1049686231 8:143940344-143940366 CACTGGCGAGGCCCCTCCTGGGG - Intronic
1050734528 9:8748063-8748085 CATTGAAGGCACCCCTCCTGAGG + Intronic
1055667308 9:78565624-78565646 CACAGATGACGCCCGTCCTTGGG - Intergenic
1057058387 9:91981621-91981643 CATTGAAGCCACCCCTCCTGAGG + Intergenic
1062023756 9:134331071-134331093 CACTGAGGTAGCCCTTTCTGTGG + Intronic
1187388658 X:18871616-18871638 CCCTGATGACTCCCTTCCTGGGG + Intergenic
1193990372 X:88299634-88299656 CACTGTTGTTGCCCAGCCTGGGG - Intergenic
1200109813 X:153734662-153734684 CACTGATGTCGCCCCTCCTGGGG - Intronic
1201471593 Y:14341152-14341174 CACTGAAGACTCCCCTCCTGAGG - Intergenic