ID: 1200110180

View in Genome Browser
Species Human (GRCh38)
Location X:153736984-153737006
Sequence GGTCCCTAGGGAACACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 143}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200110180_1200110192 24 Left 1200110180 X:153736984-153737006 CCTGGCTGTGTTCCCTAGGGACC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1200110192 X:153737031-153737053 AACCAGCTGGCATGCTGCCAGGG 0: 1
1: 0
2: 0
3: 13
4: 159
1200110180_1200110195 29 Left 1200110180 X:153736984-153737006 CCTGGCTGTGTTCCCTAGGGACC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1200110195 X:153737036-153737058 GCTGGCATGCTGCCAGGGATGGG 0: 1
1: 0
2: 5
3: 14
4: 232
1200110180_1200110191 23 Left 1200110180 X:153736984-153737006 CCTGGCTGTGTTCCCTAGGGACC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1200110191 X:153737030-153737052 GAACCAGCTGGCATGCTGCCAGG 0: 1
1: 0
2: 0
3: 18
4: 197
1200110180_1200110188 1 Left 1200110180 X:153736984-153737006 CCTGGCTGTGTTCCCTAGGGACC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1200110188 X:153737008-153737030 TGGACCACAGGCTGCTGGTCAGG 0: 1
1: 0
2: 1
3: 17
4: 266
1200110180_1200110185 -4 Left 1200110180 X:153736984-153737006 CCTGGCTGTGTTCCCTAGGGACC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1200110185 X:153737003-153737025 GACCCTGGACCACAGGCTGCTGG 0: 1
1: 0
2: 2
3: 20
4: 399
1200110180_1200110194 28 Left 1200110180 X:153736984-153737006 CCTGGCTGTGTTCCCTAGGGACC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1200110194 X:153737035-153737057 AGCTGGCATGCTGCCAGGGATGG 0: 1
1: 0
2: 3
3: 31
4: 308
1200110180_1200110190 11 Left 1200110180 X:153736984-153737006 CCTGGCTGTGTTCCCTAGGGACC 0: 1
1: 0
2: 0
3: 12
4: 143
Right 1200110190 X:153737018-153737040 GCTGCTGGTCAGGAACCAGCTGG 0: 1
1: 0
2: 2
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200110180 Original CRISPR GGTCCCTAGGGAACACAGCC AGG (reversed) Intronic
900465944 1:2825505-2825527 GGCCGCGAGGGAACCCAGCCTGG + Intergenic
901793756 1:11668584-11668606 GGTCCCCAGGGAACCAGGCCAGG - Intronic
902288939 1:15424341-15424363 GGTTCCTGGAGCACACAGCCTGG - Intronic
902773232 1:18658297-18658319 GGTCCCTCGAAGACACAGCCAGG - Intronic
902781025 1:18705192-18705214 GGTCCCCAGGGAAGACATTCTGG - Intronic
903845537 1:26277881-26277903 GGGCCCTAGGGATTATAGCCAGG + Exonic
904214802 1:28910896-28910918 GGTCCTTAGGGACCCCATCCTGG + Intronic
905529107 1:38662337-38662359 TGTTCCCAGGGAACAGAGCCTGG - Intergenic
906090373 1:43173809-43173831 ATTCTCTAGGGCACACAGCCAGG + Intronic
906256896 1:44357343-44357365 GTTCCCTAGAAAACAGAGCCTGG + Intergenic
907298444 1:53470347-53470369 GGTCCCTAGGCAACAGGCCCCGG - Intergenic
911062383 1:93759452-93759474 GGCCGCTTGGTAACACAGCCAGG - Intronic
916060744 1:161097090-161097112 GGTCCTCAGAGAACACAGCATGG - Intergenic
923564987 1:235069922-235069944 GGTCCCTAGGGGACAGGGACTGG - Intergenic
1063161967 10:3424691-3424713 GGTCCCCAGGGGAGACAGCGGGG - Intergenic
1063670416 10:8095540-8095562 ATTCCCCAGGGAACACAGCAGGG + Intergenic
1064255731 10:13741568-13741590 GGGCCCCAGGGAGCTCAGCCCGG - Intronic
1067973800 10:51001213-51001235 GCTCCCCAGGGAACCCAGACTGG - Intronic
1070915915 10:80154687-80154709 GGTCCCCAGAGACCAGAGCCAGG + Exonic
1075672044 10:124269461-124269483 GGCCCATAGGGAAGACAGCATGG - Intergenic
1075672128 10:124270044-124270066 GGCCCATAGGGAAGACAGCATGG - Intergenic
1077256587 11:1586843-1586865 GATCCCTTGGGAAGACAGCTTGG - Intergenic
1077391877 11:2304040-2304062 GGTCCTGAGTGCACACAGCCTGG - Intronic
1080128619 11:28766943-28766965 GGTCCATGGGGAATACTGCCTGG - Intergenic
1080308144 11:30858884-30858906 GGTACCTGGGGAAGACAGGCAGG - Intronic
1080403716 11:31959804-31959826 CGTGTCTAGGGAGCACAGCCAGG + Intronic
1083620810 11:64048454-64048476 GGTCCCTGGCAACCACAGCCTGG - Intronic
1085641654 11:78196699-78196721 GGTCCGTCGGGCACACAGCGCGG - Exonic
1085980563 11:81718890-81718912 GGCCCATAGGGAATACTGCCAGG - Intergenic
1089353502 11:117834980-117835002 GGCCTCTAGGGATCTCAGCCTGG + Intronic
1090400010 11:126443018-126443040 GCCCCCTGGGGAACACAGGCCGG - Intronic
1091589735 12:1836115-1836137 GCTCCCTAGAGCACCCAGCCGGG + Exonic
1091820740 12:3473607-3473629 GGTCCTTAGGAAACACACCTGGG - Intronic
1096967820 12:55642653-55642675 TTTCCCTAGGTAACACAGCTAGG + Intergenic
1110886057 13:80636872-80636894 GGCCCATAGGGAATACTGCCAGG + Intergenic
1112007441 13:95266399-95266421 CATACCAAGGGAACACAGCCTGG + Intronic
1113576016 13:111395937-111395959 CCACCCTAGGGAACACAGCAGGG - Intergenic
1121959188 14:98243031-98243053 GGAACCTAAGGCACACAGCCTGG - Intergenic
1122429634 14:101632176-101632198 GGTCCCTAAGGGACAGAGCAAGG + Intergenic
1122801153 14:104230257-104230279 CTTCCCAAAGGAACACAGCCTGG + Intergenic
1125557097 15:40594736-40594758 GGTCCCTAGGGAAGAGCGGCAGG - Intronic
1128085600 15:64884249-64884271 GGGCCCTAGGGGAAAGAGCCTGG + Intronic
1128781320 15:70360529-70360551 GGCCCCTTTGGAAAACAGCCTGG + Intergenic
1130655499 15:85789609-85789631 TGTCCCTTGGGCACAGAGCCAGG - Intronic
1132516792 16:369816-369838 GGGCCCTGGGGATTACAGCCTGG - Intronic
1132679232 16:1132978-1133000 GGCCCCCAGGGAACCCAGCCTGG + Intergenic
1133782578 16:8951430-8951452 GCTCCACAGAGAACACAGCCCGG + Intronic
1136269028 16:29137705-29137727 GGTCCCCTGAGAGCACAGCCAGG + Intergenic
1136282622 16:29222660-29222682 GGTCCCCAGGCACCACTGCCAGG + Intergenic
1138218395 16:55226219-55226241 GGTTCCTTGGGGATACAGCCAGG + Intergenic
1139334615 16:66223122-66223144 GGTTCCCAGGGAATACAGCAAGG - Intergenic
1139593695 16:67946631-67946653 GGTCTGTGGGGAACACACCCAGG + Exonic
1140855383 16:78973310-78973332 GTTCCCTAGTGGAGACAGCCGGG + Intronic
1141909002 16:87045748-87045770 GGTCCCCAGGGAACACGGCGTGG + Intergenic
1142072334 16:88098072-88098094 GGTCCCCTGAGAGCACAGCCAGG + Intronic
1142086996 16:88188585-88188607 GGTCCCCAGGCACCACTGCCAGG + Intergenic
1142232098 16:88904793-88904815 TCTCCCTAGGCCACACAGCCAGG - Intronic
1143104624 17:4522771-4522793 GGACCCTAGGTCACACAGCGAGG - Intronic
1143753730 17:9051106-9051128 GGACCCTCGGGAAGGCAGCCTGG + Intronic
1143918557 17:10312946-10312968 GGTCCCTAAGGAGCACCTCCAGG + Intronic
1146703335 17:34980857-34980879 GTTCCACAGGGAACACAGCCCGG - Intronic
1147183127 17:38699350-38699372 GGTCCCTGGTGACCTCAGCCTGG - Intergenic
1147748247 17:42709390-42709412 AGTCACTAGGGAACAGGGCCAGG + Intronic
1151971759 17:77460981-77461003 GGGCCCTGGGTAACACAGACTGG - Intronic
1153986702 18:10357286-10357308 GGTGGCTAGGGATCATAGCCTGG - Intergenic
1158734346 18:60062668-60062690 GGTCGCTCTTGAACACAGCCTGG + Intergenic
1160660022 19:293566-293588 TGTCTCTAGGGGACCCAGCCTGG - Intergenic
1160875056 19:1293073-1293095 GCTCCCTGGGGATCACTGCCGGG + Intronic
1160875385 19:1294260-1294282 GGGCCCTGGGGACCACAGCCGGG + Intronic
1161059545 19:2208114-2208136 GGACCCTGGGGAACACAGGGAGG - Intronic
1161358295 19:3831874-3831896 GGTCCCTAGGGGACAGGGACAGG + Exonic
1163013594 19:14440528-14440550 GGACCCTAAAGAACAGAGCCCGG - Intronic
1165478459 19:36046577-36046599 GAACCCCAGGGCACACAGCCAGG + Intronic
1165749658 19:38252204-38252226 GGTCTCTGGGGAACACCACCCGG - Intronic
1166267012 19:41690656-41690678 GGTCTCCAGAGACCACAGCCAGG + Intronic
1168511069 19:56973954-56973976 GGTCTTTAGGGAAAACAGGCTGG + Intergenic
925330227 2:3052972-3052994 AGTTCCTGGGGAACACTGCCGGG + Intergenic
926518865 2:13884172-13884194 GGTGACTAGAGACCACAGCCTGG - Intergenic
927246021 2:20957855-20957877 CTTCCCTAGAGAACAGAGCCAGG - Intergenic
927256618 2:21045086-21045108 GGTGCCTTGGGGACACAGCCAGG - Intergenic
929797197 2:45069230-45069252 TTGCCCAAGGGAACACAGCCAGG + Intergenic
935022172 2:99242074-99242096 GGTCCCTAGGTATTCCAGCCAGG - Intronic
936370596 2:111898989-111899011 CGTCCCGAGGGCACCCAGCCTGG + Intronic
938305626 2:130252419-130252441 GGTCTCCAGGGGACACAGCTGGG - Intergenic
938767269 2:134468724-134468746 GGCCCCTAGGGCACAGGGCCTGG + Intronic
943767343 2:191677630-191677652 GGTACCAAGGGAAAACAGGCTGG - Intergenic
948488839 2:238298359-238298381 GTTCCCTAGAAAACAGAGCCAGG - Intergenic
1168836639 20:881972-881994 TGGCCCAAGGGCACACAGCCAGG + Intronic
1168898728 20:1341949-1341971 TGTCCTTTGGGACCACAGCCCGG - Intronic
1172701439 20:36855891-36855913 GGCCCCTAGACCACACAGCCTGG + Intronic
1173167196 20:40693494-40693516 GGTCCCCAGGAGAGACAGCCAGG - Intergenic
1175408823 20:58752719-58752741 GGACCCTTGGGATGACAGCCTGG - Intergenic
1175844232 20:62050283-62050305 GGTCCATGGGGAGCAGAGCCAGG - Intronic
1176215822 20:63947279-63947301 GTCCCCTAGGGGACAGAGCCTGG - Intronic
1178417153 21:32413028-32413050 GGTGCCGGGGGCACACAGCCAGG - Intronic
1179050459 21:37884712-37884734 GGTCCCTGGGGATGAGAGCCAGG - Intronic
1180103549 21:45601735-45601757 GGTCCCCAGGGCCCACAGCAAGG + Intergenic
1181090156 22:20467012-20467034 GGGCCCTAGGGAAAACTGCCTGG + Intronic
1182367916 22:29791035-29791057 GGGACCTAGGGACCACAGACAGG + Intronic
1183648099 22:39138422-39138444 GGTGCCCGGGGAAGACAGCCTGG - Intronic
1183747753 22:39701499-39701521 GGTCCCTACAGAACACTGCCAGG + Intergenic
1183937378 22:41270954-41270976 GGACTCTAGGGCACACCGCCTGG + Intronic
952220717 3:31321457-31321479 AGTCCATAGGAAGCACAGCCTGG + Intergenic
963328853 3:143892135-143892157 GTTCCCTAGGAAACAAAGCCTGG - Intergenic
966759907 3:183408468-183408490 GGTCCCTAGGGGCCAGAACCAGG - Intronic
969055098 4:4396713-4396735 GGTCATTAGGGAACACACCAGGG - Intronic
970362118 4:15320673-15320695 GTTCCCTTGGAAAGACAGCCAGG + Intergenic
970850676 4:20598851-20598873 GGCCCGTGGGGAACACAGACAGG - Intronic
971669920 4:29543146-29543168 GGTCCATGGAGCACACAGCCTGG + Intergenic
972676962 4:41269304-41269326 GGACATTAGGGAAAACAGCCAGG - Intergenic
978116209 4:105022858-105022880 GGTCCATGGGGCACACTGCCAGG - Intergenic
979089280 4:116459527-116459549 GGTCTCAAGGGAGCACACCCTGG + Intergenic
985850320 5:2383809-2383831 GGCACCCAGGGAGCACAGCCCGG + Intergenic
988669369 5:33364447-33364469 GGGCTCTAGTGAACTCAGCCTGG - Intergenic
997446358 5:133943177-133943199 GGTCCCCAGCAAAGACAGCCTGG - Intergenic
998091530 5:139373702-139373724 AGTCCCTAGGGAAGACTACCTGG + Intronic
1001432094 5:171670449-171670471 GGTCTCTGGGCTACACAGCCTGG - Intergenic
1001899407 5:175412767-175412789 GCTCCAGAAGGAACACAGCCAGG - Intergenic
1003886538 6:10526597-10526619 CCTGCCTAGGCAACACAGCCAGG - Intronic
1006195894 6:32242160-32242182 GGATGCTGGGGAACACAGCCTGG + Intergenic
1006614562 6:35317776-35317798 GGTCCCCAGGGAAGATAGCCAGG + Intronic
1006984759 6:38169101-38169123 GGTCCTCAGGGAGCACAGCCCGG - Exonic
1011693134 6:89887948-89887970 GGGTGCTAGGGCACACAGCCAGG - Intergenic
1014418655 6:121214578-121214600 GGGCACCAGGGAACACAGCAGGG + Intronic
1015043288 6:128747114-128747136 GGGGCCTAGTGAACACAGCTTGG + Intergenic
1017116100 6:150978436-150978458 AGCACCTGGGGAACACAGCCAGG - Intronic
1019359062 7:595446-595468 GGTCTGTGGGGAACACAGGCAGG - Intronic
1019428493 7:988096-988118 TGACCCCAGGGCACACAGCCAGG - Intronic
1022575120 7:31489975-31489997 TGTCCCTGGGGAACCCAGGCTGG + Intergenic
1026564938 7:71481901-71481923 AGTCCACAGGGAAGACAGCCAGG - Intronic
1029224000 7:99011915-99011937 CGTCCTGAGGGCACACAGCCTGG + Intronic
1033236440 7:139641582-139641604 GATGCCCAGGGAGCACAGCCCGG + Intronic
1034878362 7:154744862-154744884 GGAGCCCAGGGAGCACAGCCAGG + Intronic
1037710447 8:21351257-21351279 GGGCTCTCGGGAGCACAGCCTGG - Intergenic
1048558361 8:135505370-135505392 GGTCCCAAGGGACCACAAGCAGG - Intronic
1049261542 8:141641705-141641727 GGTCCCTGGGGGCAACAGCCAGG + Intergenic
1049332690 8:142063613-142063635 CTCCCCTAGGGAGCACAGCCAGG - Intergenic
1049409964 8:142468664-142468686 GGTCTCTAGGGAAGACTTCCTGG - Intronic
1051386779 9:16517979-16518001 GGTCTCGAAGGAACACAGACTGG + Intronic
1051596057 9:18825274-18825296 GGTCCCTAGAGCACAGAGCCTGG + Intronic
1053173045 9:35904641-35904663 CTTCCCTAGGGAAGGCAGCCGGG + Intergenic
1057698901 9:97348864-97348886 GGAGCAGAGGGAACACAGCCAGG - Intronic
1061043752 9:128153551-128153573 GGAGCCTAGCGAACCCAGCCTGG + Intergenic
1061913119 9:133735258-133735280 GGCCCCAAGGGAGCAGAGCCGGG - Intronic
1062125803 9:134861751-134861773 GAACACTAGGGAACGCAGCCTGG - Intergenic
1187245296 X:17548422-17548444 GATCCCCAGGGAACAGAGGCTGG + Intronic
1192189782 X:68983747-68983769 GGTCCCCAGGGGGCACTGCCTGG - Intergenic
1192875202 X:75222624-75222646 GGCCCATGGGGAACACTGCCAGG + Intergenic
1195241691 X:102959313-102959335 GGCCCATGGGGAACACAGACTGG + Intergenic
1198566987 X:137915203-137915225 GGTCCCAAGGGAACAAAGAGAGG - Intergenic
1200110180 X:153736984-153737006 GGTCCCTAGGGAACACAGCCAGG - Intronic
1200708145 Y:6460391-6460413 CATCCCTAGGGAACACAGGTGGG + Intergenic
1200918663 Y:8593653-8593675 GGTCCATGGGGAACACAGGCAGG - Intergenic
1200922716 Y:8627469-8627491 GGACCCCTGGGAACACAGACAGG - Intergenic
1200930889 Y:8696076-8696098 CCACCCTAGGGAACACAGGCGGG + Intergenic
1201025967 Y:9704317-9704339 CATCCCTAGGGAACACAGGTGGG - Intergenic