ID: 1200111866

View in Genome Browser
Species Human (GRCh38)
Location X:153744583-153744605
Sequence TTCCCAGCTCAGTGCCAAAG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 4, 1: 3, 2: 0, 3: 20, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1200111864_1200111866 -3 Left 1200111864 X:153744563-153744585 CCAGGAGTGCGGACACCATGTTC 0: 4
1: 1
2: 1
3: 3
4: 94
Right 1200111866 X:153744583-153744605 TTCCCAGCTCAGTGCCAAAGAGG 0: 4
1: 3
2: 0
3: 20
4: 185
1200111858_1200111866 28 Left 1200111858 X:153744532-153744554 CCACCGGGGCACACGGGCCTCTG 0: 1
1: 0
2: 1
3: 16
4: 172
Right 1200111866 X:153744583-153744605 TTCCCAGCTCAGTGCCAAAGAGG 0: 4
1: 3
2: 0
3: 20
4: 185
1200111863_1200111866 1 Left 1200111863 X:153744559-153744581 CCAGCCAGGAGTGCGGACACCAT 0: 1
1: 0
2: 1
3: 9
4: 111
Right 1200111866 X:153744583-153744605 TTCCCAGCTCAGTGCCAAAGAGG 0: 4
1: 3
2: 0
3: 20
4: 185
1200111861_1200111866 11 Left 1200111861 X:153744549-153744571 CCTCTGCTTGCCAGCCAGGAGTG 0: 1
1: 0
2: 6
3: 41
4: 607
Right 1200111866 X:153744583-153744605 TTCCCAGCTCAGTGCCAAAGAGG 0: 4
1: 3
2: 0
3: 20
4: 185
1200111859_1200111866 25 Left 1200111859 X:153744535-153744557 CCGGGGCACACGGGCCTCTGCTT 0: 1
1: 0
2: 6
3: 28
4: 216
Right 1200111866 X:153744583-153744605 TTCCCAGCTCAGTGCCAAAGAGG 0: 4
1: 3
2: 0
3: 20
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1200111866 Original CRISPR TTCCCAGCTCAGTGCCAAAG AGG Exonic
900547391 1:3236438-3236460 TGCCCACCTCATTGCCAATGCGG - Intronic
902834919 1:19040833-19040855 CTCCCAGCTCAGGGCCAAGAGGG - Intergenic
904817595 1:33217124-33217146 TTCCTGGCTCAGTGCTAAGGAGG + Intergenic
904827849 1:33286640-33286662 GTCCTAACTCAGTGGCAAAGAGG + Intronic
906069573 1:43007331-43007353 TGCACAGCTCTGTGCCAAGGAGG - Intergenic
908165884 1:61458138-61458160 TGCCCAGCTAAGTGCTATAGGGG - Intronic
908724794 1:67163933-67163955 TACCCAGACCAGTGTCAAAGAGG - Intronic
910037322 1:82803974-82803996 TTCCCAGGTCAGTTCAAAATGGG + Intergenic
910289058 1:85582181-85582203 ATCCCAGCTCCTTGCCAAGGAGG - Exonic
912216322 1:107617249-107617271 TTCTCAGTTCAGTGGGAAAGGGG + Intronic
912533022 1:110339939-110339961 GTCCCAGCTTAGTGACGAAGCGG + Exonic
913034959 1:114955882-114955904 TTGCAAGCTCAGGGACAAAGAGG - Intronic
913043633 1:115054654-115054676 TTCTCTGATCAGAGCCAAAGAGG + Intronic
913281050 1:117185418-117185440 TGTCCTGATCAGTGCCAAAGTGG + Intronic
918055240 1:181015732-181015754 ATCTCAGCTCACTGCAAAAGAGG + Intronic
918363051 1:183778800-183778822 TTCCCAGATCATTACAAAAGAGG + Intronic
920365142 1:205444324-205444346 TTCCCAGCTCAGGTCCAAGATGG + Intronic
920412164 1:205770822-205770844 GTCCCGGCTCACTGCCCAAGGGG + Exonic
1065036153 10:21640843-21640865 TTCACAGCTAAGTCCAAAAGAGG + Intronic
1066746223 10:38605428-38605450 TTCCCAGCTCAGTACCAAAGAGG + Intergenic
1067441406 10:46310982-46311004 TTCCCAGCTCGGTGCCCACCAGG - Intronic
1073562999 10:104512777-104512799 TTCCCAGCTCAGGCCCAAGTCGG - Intergenic
1075923779 10:126234869-126234891 TCCCCATCTCAGGGTCAAAGGGG + Intronic
1077508815 11:2944736-2944758 TTCCCAGCCCAGTCCCTCAGTGG + Exonic
1078665341 11:13320254-13320276 ATACCAGCTCAGAGCCAGAGAGG - Intronic
1081761379 11:45578463-45578485 TTCCCAGCTGAGTCCAGAAGAGG - Intergenic
1083260555 11:61520413-61520435 CTCCCACCTCAGTCCCCAAGTGG - Intronic
1085198524 11:74687111-74687133 TTCCATGCTCACTGGCAAAGTGG + Intergenic
1087547143 11:99598663-99598685 TTCCCATCTGAGTGCTAAACTGG - Intronic
1087600684 11:100311124-100311146 TTCCAACCTCAGTGACAATGAGG + Intronic
1090028311 11:123186062-123186084 TTCCCAGATCAGTGCTGAAGAGG + Intronic
1090263977 11:125342614-125342636 TTCTCAGCTCAGTGCCTGAGCGG + Intronic
1092574664 12:9767270-9767292 TGCCCAGCTCTGTTCCAGAGTGG + Intergenic
1093749685 12:22783851-22783873 CTCCCAGCCCAGGGCCAATGTGG - Intergenic
1094170499 12:27486253-27486275 TGCCCAGCAGAGTGCCAAAGAGG - Intronic
1094475816 12:30839846-30839868 GTCCCAGCTGTGTGTCAAAGAGG - Intergenic
1096216122 12:49798357-49798379 TGCCCAGCACAGTGCCCCAGAGG + Exonic
1097513185 12:60568555-60568577 TTACCAGCTCATTGGCAAAAGGG + Intergenic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1099304373 12:80936870-80936892 CTCCCAGCTCGGTGCCACCGCGG - Intronic
1102072963 12:110036867-110036889 TTCACAGGTCAGTGCCATTGGGG + Intronic
1103368988 12:120403904-120403926 TTGCCAGCTCCGTGCCAATGAGG - Intergenic
1103730323 12:123022979-123023001 CTCCCAGCTCCCTGCCACAGGGG + Intronic
1104756829 12:131274457-131274479 TTCCCAGCTCAGTCCCAGGGAGG - Intergenic
1106469852 13:30044678-30044700 TGCCCAGGTCATTGCTAAAGAGG + Intergenic
1107341136 13:39407471-39407493 TTCCCAGGTAAGTGCCAAATGGG + Intronic
1112429284 13:99336398-99336420 TTGCCACCCCAGTGCCAAAAAGG + Intronic
1113228511 13:108185448-108185470 TTCCCATCTCAGAGCCAATCTGG + Intergenic
1113966960 13:114158219-114158241 CTCCCAGCTCAGTGCCACTCTGG + Intergenic
1114669651 14:24402350-24402372 TCCTCACCTCACTGCCAAAGGGG - Intronic
1118828175 14:69403407-69403429 TTACCAGCTCTGTGACAAAGAGG - Intronic
1121547365 14:94771732-94771754 TCCCCGGCTCAGGGGCAAAGGGG + Intergenic
1123216291 14:106812594-106812616 TTCCCATCTCAGTTCCTGAGGGG - Intergenic
1127600342 15:60529581-60529603 ATACCTCCTCAGTGCCAAAGTGG - Intronic
1128439218 15:67688273-67688295 TTTCCAACTCAGTGCAAAAATGG - Intronic
1129518295 15:76170383-76170405 ATCCCAGCACTGAGCCAAAGAGG - Intronic
1130561538 15:84963126-84963148 TTGCCAGCTCAGTGGGATAGTGG + Intergenic
1131122027 15:89828717-89828739 CTCCCACCACAGTGCCCAAGTGG + Intergenic
1131205522 15:90442575-90442597 TTCCCAGTTAGGTGCCAAACTGG + Intronic
1132413670 15:101604889-101604911 TTCCAAGCTCACTGCCATGGTGG - Intergenic
1133800931 16:9084737-9084759 TTCCCAGGTCAGAAACAAAGCGG + Intergenic
1133972466 16:10577905-10577927 TTCCCAGCTCTGTGGCCAAGTGG - Intronic
1134539676 16:15054936-15054958 TTCCCATCTCAGAGTGAAAGGGG + Intronic
1135933103 16:26756289-26756311 GACCAAGCTCAGTGCCAAGGTGG - Intergenic
1136008660 16:27348177-27348199 TACCTGGCCCAGTGCCAAAGGGG - Intronic
1136549985 16:30977826-30977848 TTCCCCGCTCAGCGCCAACAGGG - Intronic
1136573487 16:31110023-31110045 TTCTCTGCTCAGTGCCCATGCGG + Intronic
1136736833 16:32474213-32474235 TTCCCAGCTCAGTGCCAAAGAGG - Intergenic
1136869808 16:33796237-33796259 TTCCCATCTCAGTTCCTAAGAGG + Intergenic
1137570041 16:49559266-49559288 TTTCCTACTCAGTACCAAAGGGG + Intronic
1139213499 16:65104629-65104651 TTAAAAGCGCAGTGCCAAAGGGG - Intronic
1141862333 16:86726385-86726407 TTCCCAGCTATGTGTAAAAGAGG - Intergenic
1142138895 16:88463872-88463894 TTCCCTGCTCTGGGCCAAGGTGG + Intronic
1203016236 16_KI270728v1_random:355364-355386 TTCCCAGCTCAGTGCCAAAGAGG + Intergenic
1203034571 16_KI270728v1_random:628522-628544 TTCCCAGCTCAGTGCCAAAGAGG + Intergenic
1203102364 16_KI270728v1_random:1319818-1319840 TTCCCATCTCAGTTCCTAAGAGG - Intergenic
1142702567 17:1672939-1672961 TTCCATGCTCTGTGCCATAGTGG - Intronic
1147260524 17:39207365-39207387 TTCCCAGGCCAGTGCCTAGGAGG + Intergenic
1148559208 17:48596436-48596458 GTCTCAGCTCAGTGCCGAGGAGG - Exonic
1150694298 17:67390933-67390955 TTCCCAGCACTTTGACAAAGGGG + Intronic
1150885573 17:69081972-69081994 TTCCCAGCTTATTCCCAAACAGG + Intronic
1151424023 17:74018080-74018102 TTCCCACCCCTCTGCCAAAGGGG - Intergenic
1151439787 17:74120697-74120719 TTCTAAGCCCACTGCCAAAGTGG + Intergenic
1151877907 17:76877739-76877761 TTCCCTTCTCAGTGCCAGGGAGG + Intronic
1153516034 18:5902049-5902071 TACCCAGCACAGTGCCCAATAGG - Intergenic
1154463868 18:14623494-14623516 TTCCCAGCACAGTGCCTTTGTGG - Intergenic
1154930134 18:20985657-20985679 TTCCTAGCACAGAGCCAAATAGG + Intronic
1155346937 18:24866674-24866696 TGCTCAGCTCACTGCCCAAGGGG + Intergenic
1156545403 18:37958909-37958931 TTCCCAGTTCAGGGCCACACTGG + Intergenic
1158479582 18:57808931-57808953 TTCACATCTCAGTTCCCAAGTGG + Intergenic
1160865995 19:1256173-1256195 CTCCCAGCTCAGTTTAAAAGTGG + Intronic
1166347246 19:42174424-42174446 TTCCACGCACAGAGCCAAAGAGG + Intronic
1167357459 19:49012656-49012678 TTCCCAGCTGAGTGTGAACGAGG + Intronic
1168152949 19:54458747-54458769 TTCCCAGCTCACTGCCTCTGGGG + Intronic
1168282079 19:55311363-55311385 TTTCCACCTCAGTCCCCAAGAGG + Intronic
925140399 2:1546360-1546382 TTCACAGCTGAGTGAGAAAGTGG - Intergenic
926040351 2:9667732-9667754 TTCCCTGCTTAAAGCCAAAGAGG + Intergenic
928582057 2:32718809-32718831 TTCCCAGTTCAGAGCCTTAGGGG - Intronic
929556482 2:42928733-42928755 GTACTTGCTCAGTGCCAAAGGGG + Intergenic
930384634 2:50678729-50678751 CTCCCAGCTCAGTGCCAGACTGG + Intronic
931230026 2:60366313-60366335 TTCCCAGCTGGGGGCCCAAGTGG + Intergenic
934308629 2:91844620-91844642 TTCCCAGCTCAGTGCCAAACAGG + Intergenic
934947367 2:98551563-98551585 TTCCCAGGGAAGTCCCAAAGTGG - Intronic
937647600 2:124283363-124283385 TTGCCAGCTCAGGGGCAAAGAGG + Intronic
942759535 2:179382486-179382508 TTGCAAGCTCAATGCCAAACAGG - Intergenic
943106869 2:183555789-183555811 TTCCTAGCTAATTGCCAAGGAGG + Intergenic
943613968 2:190070093-190070115 TTCCTGGGTCAGTGCCACAGTGG + Intronic
944599155 2:201285515-201285537 TTCCCAGGTCAGTTACAAAGTGG + Intronic
945477371 2:210300459-210300481 TTCACACCTCAGTGACAGAGTGG + Intronic
947637165 2:231686014-231686036 TGCCAAGGCCAGTGCCAAAGAGG + Intergenic
947739102 2:232476811-232476833 TTCCCATCCTAGGGCCAAAGAGG - Intergenic
1169520743 20:6370396-6370418 TGGCCAGCTCAGAGCCAGAGTGG + Intergenic
1170299079 20:14861738-14861760 TGCCCAGCTCAATGCCAAGATGG - Intronic
1172658478 20:36550614-36550636 GTCCCAGATCAGGGCCAAGGGGG + Exonic
1172890739 20:38262046-38262068 TGCCCAGCTTAGTGCCCAAGAGG + Intronic
1173018845 20:39250191-39250213 TACTCAGCTCAGTGCCACATAGG - Intergenic
1173110082 20:40178726-40178748 TTCCTAGAACAGTGCCAAACAGG - Intergenic
1174615479 20:51832371-51832393 TTCCCTCCTCTGTGCCCAAGAGG + Intergenic
1175948237 20:62568631-62568653 TTGCCAGCTCAGTGACCGAGAGG + Intronic
1176810663 21:13534879-13534901 TTCCCAGCACAGTGCCTTTGTGG + Intergenic
1178395744 21:32241721-32241743 TTAACAGCTCAGAGGCAAAGCGG + Intergenic
1178445003 21:32631655-32631677 TTCCCACCCCAGACCCAAAGAGG - Exonic
1180535714 22:16391699-16391721 TTCCCAGCTCAGTGCCAAACAGG + Intergenic
1182048140 22:27292524-27292546 TGCCCAGCTCTGAGCCAAGGGGG + Intergenic
1183479966 22:38058036-38058058 ATCACAGCTCAGTGCCATAAGGG + Intronic
1185102117 22:48846154-48846176 TTCCCAGCACTGGGCCAGAGAGG - Intronic
950169354 3:10827090-10827112 ATCTCAGCTCAGGGGCAAAGAGG - Intronic
951712983 3:25603893-25603915 ATTCCAGCACAGTGGCAAAGAGG + Intronic
955239944 3:57169379-57169401 TTCTCAGCTTTGTTCCAAAGAGG - Intronic
956168615 3:66415134-66415156 TTCCCAACTCAGACCCAGAGAGG - Intronic
962887668 3:139642512-139642534 TTCCCAGGGCAGCGCCACAGTGG - Intronic
963290648 3:143483720-143483742 TTCTCTGCCCAGTGCCAAAAAGG + Intronic
966305307 3:178526358-178526380 TCCCAGGCTTAGTGCCAAAGAGG + Intronic
968036286 3:195550862-195550884 TTCCTAGCACAGAGCCAAATGGG - Intergenic
968622465 4:1610146-1610168 CTGCCAGCTCAGTGCCGAGGGGG + Intergenic
968751907 4:2394434-2394456 TTGCCAGCTGACTGGCAAAGGGG + Intronic
969095307 4:4728523-4728545 ATGCCAGCTCAGAGCCACAGGGG - Intergenic
969427635 4:7135013-7135035 TCCCCGACTCAGTTCCAAAGAGG - Intergenic
969595056 4:8144036-8144058 TTCCCAGGTCAATGCCAAGGAGG + Intronic
969700546 4:8765384-8765406 TCCCCAGCTGTTTGCCAAAGTGG + Intergenic
970496047 4:16627333-16627355 TTTCCAGTTCAGTGAAAAAGGGG + Intronic
971298766 4:25424820-25424842 TTCCTAGCTCTGGGCCAATGTGG + Intergenic
973628725 4:52798406-52798428 ATCCAAGCTCTGAGCCAAAGTGG + Intergenic
973811585 4:54575602-54575624 TTGCCAGCTATGTGCCCAAGAGG - Intergenic
975853262 4:78595431-78595453 TGCCCAGGTCAGTAACAAAGCGG + Exonic
977423768 4:96838811-96838833 TTCCCACCTGAGTGGCTAAGGGG + Intergenic
977571577 4:98634661-98634683 TTCCCAGCTCACTGAAAAAAGGG + Intronic
978046815 4:104139772-104139794 TTCCCAGTTCTTGGCCAAAGAGG - Intergenic
979488472 4:121296275-121296297 TTCCCAGATCAATGTCAAAAAGG - Intergenic
980891256 4:138818111-138818133 TTCACAGCTCTGTTCCACAGGGG - Intergenic
992789366 5:80199824-80199846 TTCCCACCACAGTACCACAGTGG + Intronic
993145238 5:84085942-84085964 TTCCCGTGACAGTGCCAAAGAGG - Intronic
994625871 5:102218006-102218028 ATCTCATCTCAGTGGCAAAGAGG - Intergenic
997935544 5:138107440-138107462 TTCCTAGCTCTGTGACAATGGGG - Intergenic
998218395 5:140254911-140254933 TTCCCAGGTAAGTGCAACAGAGG - Intronic
998394320 5:141808694-141808716 TCCCCTGCTCAGTGCCACCGGGG - Intergenic
999275496 5:150327190-150327212 TTCTTAGCTCTGTGGCAAAGGGG + Intronic
1000548075 5:162626069-162626091 TTCCCCTGACAGTGCCAAAGAGG + Intergenic
1001257420 5:170194614-170194636 TTTCCAGCTCTGTGCCAATTTGG + Intergenic
1001282134 5:170393973-170393995 ATCCCAGCTCTGTGGGAAAGTGG + Intronic
1003116227 6:3285532-3285554 ATTCCTGCTCAGGGCCAAAGGGG + Intronic
1004263145 6:14125746-14125768 TTCAAATCTCAGTTCCAAAGGGG + Intronic
1007250608 6:40492396-40492418 CTTCCAGCTCAGTGCCAGAGAGG - Intronic
1007250897 6:40494186-40494208 TTCCCAGCTCTGTTCCTAACAGG + Intronic
1007260740 6:40561396-40561418 TTCCCAGATCAGTCCCCAACCGG - Intronic
1014507376 6:122276284-122276306 TTCCCAGACCATGGCCAAAGAGG + Intergenic
1015810943 6:137161789-137161811 TAACCAGCTCAGGACCAAAGAGG + Exonic
1016194800 6:141321700-141321722 TCACCAGTTCAGTGCAAAAGTGG - Intergenic
1017029661 6:150210152-150210174 TTCCCAGTGCAGTGGCAATGCGG + Intronic
1019858660 7:3635814-3635836 TTCCCACCTCAGCCCCTAAGTGG + Intronic
1022915450 7:34945321-34945343 TTCCCTGCTCATTTCCAAAAAGG + Intronic
1023440442 7:40179877-40179899 GTCCAAGCCCAGTGCCAACGTGG + Intronic
1023452089 7:40297503-40297525 ATCACAGCTCACTACCAAAGAGG - Intronic
1024997209 7:55280804-55280826 TTCCCACCTCAGCCCCCAAGTGG - Intergenic
1026122684 7:67551392-67551414 TTCCATGCTCAGTGCCACAGGGG + Intergenic
1026223423 7:68420168-68420190 TTCTGAGCTAAGTGCCACAGAGG - Intergenic
1028943141 7:96547841-96547863 CTCCCAGCTCAGTTAAAAAGAGG + Intronic
1030019693 7:105261132-105261154 TTTCCATCTCTGTGCCAAAATGG - Intronic
1030647710 7:112081950-112081972 TTACCAGCTCTGTGACAAATTGG + Intronic
1030671988 7:112348003-112348025 TTCCCAGTTCTTTGCCACAGTGG - Intergenic
1031971665 7:128069031-128069053 TCCCCATCACAGGGCCAAAGCGG - Intronic
1032089143 7:128902579-128902601 TGCCCAGCTCTGAGCCCAAGAGG - Intronic
1033443087 7:141397590-141397612 CTCCCAGCTCAGTTACAAATGGG - Intronic
1034479879 7:151311416-151311438 TTCCCAGGACAGTGCCCTAGTGG + Intergenic
1034921513 7:155087305-155087327 TTCCCTGCTCACAGCCAAAGAGG + Intergenic
1038078675 8:24106984-24107006 TTACCAACTCAGTTCCACAGAGG + Intergenic
1039774104 8:40718930-40718952 ATTCCAGGTCAGTGCCACAGGGG - Intronic
1041212776 8:55569414-55569436 TACCCAGCTGAGGGCCACAGAGG + Intergenic
1043665524 8:82806630-82806652 TTCAGAGTTCAGTGCCAAAGAGG + Intergenic
1044659306 8:94579524-94579546 TTTTCAGCTAACTGCCAAAGAGG + Intergenic
1045544255 8:103113972-103113994 TTCCCATCTCTTGGCCAAAGAGG - Intergenic
1047014525 8:120709705-120709727 TTCCCAACACAGTGGGAAAGAGG - Intronic
1048370832 8:133774768-133774790 TTCCCACCTCAGTGTCACATAGG - Intergenic
1049747242 8:144268216-144268238 TGCCCAGCTCAGGTCCAAGGTGG - Exonic
1049842051 8:144778995-144779017 CACCAAGCTCTGTGCCAAAGGGG + Intronic
1051089842 9:13393433-13393455 TTCCCTGCTCAGGGAAAAAGGGG + Intergenic
1053367807 9:37536076-37536098 TACCCAGCCCACTTCCAAAGAGG - Intronic
1057122224 9:92586649-92586671 TGCCCCTCTCAGAGCCAAAGTGG + Intronic
1057476968 9:95411365-95411387 TTCCCAGCTGAGTGCAGAAAGGG + Intergenic
1058635641 9:107035707-107035729 CTCCAAGCTTAGTGCCAGAGAGG + Intergenic
1060747928 9:126149870-126149892 TTCCCAGCTGAGTTCCCAAGAGG - Intergenic
1061357574 9:130118298-130118320 TTCCCAGCTGACTTCCCAAGAGG - Intronic
1061709109 9:132475480-132475502 TTATCGGCTCAGTCCCAAAGTGG - Intronic
1188438135 X:30185875-30185897 GTCCCTGTTCAGTGCCCAAGAGG - Intergenic
1190322486 X:49187082-49187104 TCCCCAGCTCAGTTCCAGGGCGG + Intergenic
1194398210 X:93412268-93412290 GTACCAGCTCAGTACCCAAGCGG + Intergenic
1194783725 X:98057145-98057167 TTCCAAGCCCAGTGACAATGTGG + Intergenic
1195446374 X:104957246-104957268 TTCCAAGCTCACTGCAGAAGTGG - Intronic
1197540726 X:127756648-127756670 ATCCCAGCTCAATGACAGAGAGG - Intergenic
1197622129 X:128762790-128762812 TTCTCAGCTCAGGGACAAACTGG - Intergenic
1199900104 X:152164725-152164747 TTCCCAGCTCCGTGTGAAAAGGG - Intergenic
1200111866 X:153744583-153744605 TTCCCAGCTCAGTGCCAAAGAGG + Exonic